ADF1, ADF1 (gene) Rosa hybrid cultivar

Gene Overview
Name ADF1
Gene Symbol ADF1
Type gene
Organism Rosa hybrid cultivar
Synonym actin depolymerizing factor 1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADF1JN048105.1-ADF1.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
actin depolymerizing factorADFRosa hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN048105.1-ADF1.m1 N/A JN048105.1

Sequence(s):
>JN048105.1-ADF1.m1423
atggccaatgcagcatctggtatggctgtgcacgatgagtgcaaattgaaatttctagagctcaagacaaagaggaccta
ccgatcaatagtgtacaagatcgaggagaagcaaaagcaagttattgtggaagcaactggggatccaacacaaacctatg
agaatttcacagatagccttccttctgatgaatgccgttatgctgtttttgatttcgattttcttacaccagagggtgtc
ccaaaaagcaggatattcttcattgcctggtctcctgatacatcaagggtgagaaacaagatgatctatgcaagctcaaa
ggacagattcaagagagagcttgatggaatttctcgtatcgagttgcaggcaactgatccatctgagattggccttgatg
ttattaagagccgtgccagctaa
back to top