ADF, ADF (gene) Fragaria x ananassa

Gene Overview
Name ADF
Gene Symbol ADF
Type gene
Organism Fragaria x ananassa
Synonym putative ADF
Description NA
Comment FaADF
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADFHQ877450.1-ADFFragaria x ananassagene
ADFHQ877449.1-ADFFragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADFHQ877450.1-ADF.m1Fragaria x ananassamRNA
ADFHQ877449.1-ADF.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
actin depolymerizing factorADFFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HQ877450.1-ADF N/A HQ877450.1
gene parsed from NCBI nr database HQ877449.1-ADF N/A HQ877449.1
mRNA parsed from NCBI nr database HQ877450.1-ADF.m1 N/A HQ877450.1
mRNA parsed from NCBI nr database HQ877449.1-ADF.m1 N/A HQ877449.1

Sequence(s):
>HQ877450.1-ADF394
atggcaatggctttcaagatggtacaatcactttccctttgttttctcatatttataacatgtttcttcattttctggct
aatctgatcaggattgtttctgggttcaatctatgttttgtgttatataggcgacaactgggatgtgggttactgatgaa
tgcaagaactcgttcatggagatgaagtggaagaaggtggctaggtacatagtgtacaagattgatgaaggatcgaggct
tgtgactgttgacaaggtgggtggacctggtgagagctatgatgatcttgcagcttctctgcccaaagatgattgcagat
atgctgttttcgatttcgatttcgtcactgtggacaattgcaagaagagcaaaatcttcttcattgcttggtca
back to top
>HQ877449.1-ADF394
atggcaatggctttcaagatggtacaatcactttccctttgttttctcatatttataacatgtttcttcattttctggct
aatctgatcaggattgtttctgggttcaatctatgttttgtgttatataggcgacaactgggatgtgggttactgatgaa
tgcaagaactcgttcatggagatgaagtggaagaaggtggctaggtacatagtgtacaagattgatgaaggatcgaggct
tgtgactgttgacaaggtgggtggacctggtgagagctatgatgatcttgcagcttctctgcccaaagatgattgcagat
atgctgttttcgatttcgatttcgtcactgtggacaattgcaagaagagcaaaatcttcttcattgcttggtca
back to top
>HQ877450.1-ADF.m1285
atggcaatggctttcaagatggcgacaactgggatgtgggttactgatgaatgcaagaactcgttcatggagatgaagtg
gaagaaggtggctaggtacatagtgtacaagattgatgaaggatcgaggcttgtgactgttgacaaggtgggtggacctg
gtgagagctatgatgatcttgcagcttctctgcccaaagatgattgcagatatgctgttttcgatttcgatttcgtcact
gtggacaattgcaagaagagcaaaatcttcttcattgcttggtca
back to top
>HQ877449.1-ADF.m1285
atggcaatggctttcaagatggcgacaactgggatgtgggttactgatgaatgcaagaactcgttcatggagatgaagtg
gaagaaggtggctaggtacatagtgtacaagattgatgaaggatcgaggcttgtgactgttgacaaggtgggtggacctg
gtgagagctatgatgatcttgcagcttctctgcccaaagatgattgcagatatgctgttttcgatttcgatttcgtcact
gtggacaattgcaagaagagcaaaatcttcttcattgcttggtca
back to top