ADF, ADF (gene) Malus x domestica

Gene Overview
Name ADF
Gene Symbol ADF
Type gene
Organism Malus x domestica
Synonym actin depolymerizing factor
actin-depolymerizing factor
putative actin depolymerizing factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ADFJN941562.1-ADF.m1Malus x domesticamRNA
ADFAY347804.1-ADF.m1Malus x domesticamRNA
ADFAF179295.1-ADF.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
actin depolymerizing factorADFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN941562.1-ADF.m1 Chr05:32476305..32477673
chr5:12293391..12294771
JN941562.1
predicted genes from whole genome assembly AY347804.1-ADF.m1 Chr12:21676953..21677336
chr12:18985414..18985797
chr12:19047253..19047637
chr12:22809082..22809466
AY347804.1
predicted genes from whole genome assembly AF179295.1-ADF.m1 Chr03:8415267..8415730
chr3:8758589..8759052
chr3:9711178..9711641
AF179295.1

Sequence(s):
>JN941562.1-ADF.m1441
atgtctttcaaacggctcggtcggccaaatgcttcatgtgccatgggggtttccgatgagagcaagaacactttcatgga
gctccataggaagaaagttcaccgcaatgtgatattcaaggttgatgagaacaagagggaggttgtagttgaaaaaattg
gcggtccggcggagagctatgatgattttgtggcagctttgccggataatgattgtcgatatgcggtatatgactttgat
ttcgtaacttctgagaactgtcaacagagcaagatcttcttcatcgcatggtccccttcaacctctcgaatccgtgcgaa
gatgctctatgccacatctaaaaacaggtttaggagggagctggagggtatccactacgagattcaggcaactgacccaa
cagagatggatcttgaggtgctcaaagaccgcgcccattga
back to top
>AY347804.1-ADF.m1281
gcaaagcggacctaccgctccatagttttcaagattgaggagaagcaaaagcaagttgtggtggaacatgttggtgaacc
agcagaaacctatgagcagttcactgagaagcttcctgctcatgaatgccgttatgctatttttgattttgactttctta
cacctgaaggtgtccagaaaagccggatattcttcattgcctggtctcctgacacatcaagggtgagaagcaagatgata
tacgcaagctccaaagacagattcaagagagagctcgatgg
back to top
>AF179295.1-ADF.m1390
atgatgacgtgcaagctgaagtttctggaattgaaggctaagagaacatatcgcttcatagtgttcaagattgacgagaa
gaaaaatgaggtgattgtggagaaactcggtgagccagctgaaagctatgaagactttactgcaaaccttcctgataatg
aatgcagatatgctgtctatgattttgactttgtgactgtagagaactgtcacaaaagcaggattttcttcgtcggatgg
tctcccgacacagcaagggtgagaaacaagatgatttatgcaagctccaaggacaggttcaagagagaattggatggcat
acaagtcgagctgcaggccactgatccatctgagataggtctcgatgttatcaaaagtcgtgcaaactaa
back to top