ALF3, ALF3 (gene) Malus x domestica

Gene Overview
Name ALF3
Gene Symbol ALF3
Type gene
Organism Malus x domestica
Synonym ALF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ALF3HM122430.1-ALF3.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ALF domain class transcription factorALFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122430.1-ALF3.m1 Chr17:17623394..17627469
chr10:24800752..24804827
chr10:28500364..28504439
HM122430.1

Sequence(s):
>HM122430.1-ALF3.m1774
atgaagggagctgatgtcgcgctctacaatcctcgaacggtcgaggaggttttcagagatttcaagggccgcagatctgg
aatgatcaaggctctcacttctgatgttgaaaaattctttcagatgtgtgatcctgagaaggagaatctctccttgtatg
gatatcctagtgagcagtgggaagtcaacctacctgctgaagaagtgcctcctgaattgccagagcctgctctgggtatc
aactttgcaagagatggcatggcagaaaaagactggctatctttggttgctgttcatagtgatgcctggctagtttctgt
tgccttctactttggtgccagatttgggtttgacaaggctgacaggaagcgactttttaatatgattaatgaactgccaa
caatatttgaagtcgtgactggtactgcaaaaaaacaagcaaaggagaagtcatcttcaaatcatggcagcaacaaatcc
aagtcaaactccaaagcgcagcgagggtccgaatctcaaggaagacattcggaagtattgcagcctaaagacgaagatga
gggcttggatgaagaggaggaggatgaacgtgaagagacatgtggagcatgtggtggaggcggaccatcctcattggacg
aaccctggattttctgtgatttttgtgagacgtggttccacatgaagtgcgtgaagatgacccctgcacgagcaaaacag
atcaagcagtacaaatgcccttcatgcagcaacaagagagcccggcctgattaa
back to top