ALF5, ALF5 (gene) Malus x domestica

Gene Overview
Name ALF5
Gene Symbol ALF5
Type gene
Organism Malus x domestica
Synonym ALF domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ALF5HM122431.1-ALF5.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ALF domain class transcription factorALFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122431.1-ALF5.m1 Chr01:26183577..26186256
chr1:21093633..21096315
chr1:21104271..21106907
chr1:26401616..26404298
HM122431.1

Sequence(s):
>HM122431.1-ALF5.m1711
atgccatcgtcgagccctcgcaccgtcgaagagatcttcaaggactacagcgcccgtcgctccgccgtcattcgcgccct
cacctacgatgtggacgagttctactccctttgcgatccagagaaggagaatttgtgcttgtatggacacccagatgagt
cgtgggaggtgaccctgccggcagaggaagttcccccggagcttcccgagcctgcactgggcatcaattttgcaagagat
gggatgaaccgtaaagattggctgtcattgattgcagtacatagcgattcttggttgctctctgtggctttctactttgg
tgctcgacttaatcggaatgagaggaagcgtctgtttagcttgacaaatgatctgcctacaatctttgaagtcgtaactg
gaaggaagcccgtaaaagacaagcccagtggggatagcggaagtaaatccaggaactcaaagagatcgattgacggacaa
gtaaggaccaacagtaaggtacatgatgtaagctatttggaggatgaagatgagcatagtgaaaccctatgtggaagctg
tgggggaaattacagtgctaatgagttttggatcggctgcgacatctgcgagaggtggtaccatgggaagtgtgtcaagg
taacaccagccaaggcagaatacattcagcagtacaaatgtccttcttgcagcacaaagaagagcaagtag
back to top