AMT1.2, AMT1.2 (gene) Pyrus pyrifolia

Gene Overview
Name AMT1.2
Gene Symbol AMT1.2
Type gene
Organism Pyrus pyrifolia
Synonym AMT1;2
Description NA
Comment ammonium transporter
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
AMT1.2JN650607.1-AMT1.2.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ammonium transporterAMTPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JN650607.1-AMT1.2.m1 scaffold03302:11099..12614
JN650607.1

Sequence(s):
>JN650607.1-AMT1.2.m11515
atggccactctgacctgcacagcctccgacttagccccacttctcaccaccgccaccaccgccctcaatgccacagccct
ctccgaattcctctgcggccgctttaacacaatctccaccaaattcgctgacaccacttacgcagtcgacaacacttacc
tcctcttctccgcctaccttgtcttcgccatgcagctcgacttcgccatgctatgcgccggctccgttcgtgccaagaac
accatgaatatcatgctcaccaacgaccttgatgccgctgccggtgccctctcctattacctcttcggctttgcctttgc
cttcggcgctccctccaacgccttcatcggccgacacttcttcggcctccgagacttcccctctgtatccggaggagact
acagcttcttcctttgccaatgggcttttgccatagccgccgctggcatcaccagcggctctatcgctgagagaacgcaa
ttcgtcgcttacctcatttactcttctttcctaaccggttttgtctacccggtcgtgtctcattggttttggtccgccga
cggatgggccagtccaacccggtccgataacttactatttggctccggttcaattgattttgccggttcgggtgtggtcc
acatggttggaggcatagccggtttatggggcgccgtgatcgaaggcccgagaattggcagatttgatcgaaccggccga
tctgtggccttgcggggtcacagcgcatccctagtcgttctcggtacgttcttgctttggttcgggtggtacgggttcaa
ccccggttcatttctcacgattttgaagagttacggcgatggtggtacttattacggtcaatggagcgccattggtagga
cagctgtcgcaacgacattggctggctgcacagccgctctcactacgttgttcggcaagcgattactggtgggtcattgg
aacgtgctcgacgtttgtaacggtctgttgggtggttttgccgcgatcacctccgggtgctcggtggtggaaccgtgggc
ggcaatcgtgtgcgggttcgtggccgcatgggttttgataggatgcaacaaggtggcggagaagctaaaatacgatgatc
cattggaggctgcccagttgcatggtggatgtggagcttgggggctgatattcacagggttgtttgcaacagaaaaatat
gtgaatgaggtgtactccggcaggtcagggcgcccgtatgggttgtttatgggtggtggtgggaggctgttggcggcgca
aattgtgcagattttggtggtggcagggtgggtcagtgctaccatgggcccgctgttctatgggcttcataagttgaagt
tattgaggatctcaagggaggatgagactcaagggatggatatgacaaggcatggtggatttgcttatgtttaccatgat
gaagatgatccgtccattaaacctgagtttatgatgcggagggttgagcctgttaatgatgccagtcctgcataa
back to top