AMT1, AMT1 (gene) Cydonia oblonga

Gene Overview
Name AMT1
Gene Symbol AMT1
Type gene
Organism Cydonia oblonga
Synonym ammonium transporter
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
AMT1FJ860900.1-AMT1.m1Cydonia oblongamRNA
AMT1FJ860899.1-AMT1.m1Cydonia oblongamRNA
AMT1FJ860898.1-AMT1.m1Cydonia oblongamRNA
AMT1FJ860897.1-AMT1.m1Cydonia oblongamRNA
AMT1FJ860896.1-AMT1.m1Cydonia oblongamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
ammonium transporterAMTCydonia oblongagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ860900.1-AMT1.m1 N/A FJ860900.1
mRNA parsed from NCBI nr database FJ860899.1-AMT1.m1 N/A FJ860899.1
mRNA parsed from NCBI nr database FJ860898.1-AMT1.m1 N/A FJ860898.1
mRNA parsed from NCBI nr database FJ860897.1-AMT1.m1 N/A FJ860897.1
mRNA parsed from NCBI nr database FJ860896.1-AMT1.m1 N/A FJ860896.1

Sequence(s):
>FJ860900.1-AMT1.m1542
atgcttacaaatgtcgttgacgccgccggaggactcttttactacctcttcggcttcgccttcgcctttggatccccctc
caatggcttcatcggccaccactttttcggcctgaaggatatcacgtcctcgactttggactacagcaacttcctctacc
agtgggcgttcgccatcgcggccgccggaaccactagcggatcgattgcagagaggacgcagttcgttgcttacttaatc
tactcctcgttcttgactggatttgtctatccggttgtttctcactggttctggtccacagacggttgggctagcgcgct
taagaccgacgaccgcctcttcggcggcggagtcatcgatttcgcaggctccggggtggtccacatggtcggcggtatcg
cgggactttggggagctttcatcgaaggcccgcgcatcggacgatttgaacgctccggccgatctgtggccctgcgcggc
cactccgcttccctcgtcgtcctcggcactttcctcctctggtttggatggtatgggttcaa
back to top
>FJ860899.1-AMT1.m1545
atgctcaccaatgttgttgacgctgccacgggcggcatcttctactacctctttggatttgcattggcctttggcacacc
gtcaaacggtttcatagggcagcacttcttcggcctcaacaagtttccctctcaatctttcgattacggttacttccttt
atcaatgggcttttgccattgcagccgctgggatcacaagtggttccattgctgaacgaacccaattcgtcgcgtacttg
atttattcgtccttcctgactggatttgtctacccaattgtgtcccattggttctggtctgctgacggatgggctagccc
ggcacgtgctgacaatctcctattcgaatctggggtcattgatttcgcaggctccggcgttgttcacttggttggtggca
ttgctggcctgtggggtgccctaattgaaggcccccgcattggacgttttgatcacgaaggcaagtccgcggcaatgcgt
ggacacagcggcacattggttgttttgggcacgtttcttctctggttcggctggtacggattcaa
back to top
>FJ860898.1-AMT1.m1551
atgcttactaacgtggtcgatgctgccaccggcggcctcttctactacctcttcggctacgccttcgccttcggcggccc
ctccaacggcttcatcggccaccacttcttcggcctcagcaaagttccctccgccgccaccggtttcgactacagccact
tcctctaccagtgggccttcgccatcgccgccgccggaatcaccagcggatccattgccgagaggactcagttcgtcgcc
tacctcatctactcctccttcctcaccggcttcgtctacccggtcgtctcgcactggttctggtcagtcgacggctgggc
tagcgccggaaatatcgaaaacctcttattcggaactggagtcatcgattttgccgggtcgggtgtggtccatatggtcg
gaggcatcgccggtctctggggagctttcatcgaaggcccccgaatgggtcggttcgaccactccggccgcgccgtcgct
ctccgcggacacagcgcttctctcgttgttctcggcacgtttttactgtggttcggctggtttgggtttaa
back to top
>FJ860897.1-AMT1.m1554
atgctcaccaacgtagtcgatgccgtggtaggtagcctctcctactacctcttcggctttgcctttgcattcggagaagg
ctcaaatgccaacccttttattggtacaagtttctttgctctcaaggacattcccaactccaccgacgactatgactaca
gcttcttccttttccaatgggcttttgccatagccgttgcgggtataaccagtgggtcagttgctgagcgtacccaattt
agtgcgtacctcattttctcttgctttctttccgggtttgtgtaccccgtggtggctcattgggtatggtcttccactgg
gtggcttagtccaaattcgagtaacttgttgttgggctctggggccattgactttgccgggagtggcgtggtccatttgg
ttggcggggttgccgggctttggggctctctcatcgaaggccccagagtgggacggtttgacgcgtttgggaaggccaca
cccattagaggccataacgcgacgctcgtggtgcttgggacgttcttgttgtggttcggctggtttggattcaa
back to top
>FJ860896.1-AMT1.m1548
atgctcaccaatgttctcgacgccgctgccggtgccctctcctattacctcttcggctttgcctttgccttcggcgctcc
ctccaacgccttcatcggccgacacttcttcggcctccgagacttcccctccgtatctggaggcgactacagcttcttcc
tctaccaatgggcttttgccatcgccgccgctggcatcaccagcggctctatcgctgagagaacgcaattcgtcgcttac
ctcatttactcttctttcctaaccggttttgtctacccggtcgtgtctcattggttttggtccgctgatggatgggccag
tccaatccggcccgataacttactctttggttccggttcaattgattttgccggttcgggtgtggtccacatggttggag
gcatagccggtttatggggcgccgtgatcgaaggcccgagaattggcagatttgatcgaaccgggcgatctgtcgccttg
cggggtcacagcgcgtccctagtggttctcggtacgttcttgctttggttcggctggtacggattcaa
back to top