ANR2B, ANR2B (gene) Malus x domestica

Gene Overview
Name ANR2B
Gene Symbol ANR2B
Type gene
Organism Malus x domestica
Synonym anthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANR2BJN035301.1-ANR2B.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN035301.1-ANR2B.m1 Chr05:45822429..45824663
chr5:2237237..2239373
chr5:2230379..2232604
chr5:2243505..2245739
chr5:2430079..2432313
JN035301.1

Sequence(s):
>JN035301.1-ANR2B.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggcaccgggttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagacccagacaatcacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttagcaggagatctgactgatgaagggagcttcgatgctccgatagcaggt
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcagaggacccggagaacgacatgatcaaaccggcaat
ccaaggggtactgaacgttctgaaatcgtgtgtgaaggccaaaacagttaagcgtgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgagggaacaggtttggtcatggacgaaaaagattggagtgatttggagttcttgactact
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaattcgccgaagagaacaa
tattgatctcatcactgtgatcccttctcttatggctggtccttctctcactccagacgtccccagcagtatcggccttg
ccatgtctttaatcacaggaaatgatttcctcataaatatggccttgaaaggtatgcaaatgctatcaggttcgatatcc
atttcacatgtggaggatgtctgccgggcgcatatatttttggctgagaaagaatctgcttctggtcggtacatttgctg
tgctgccaacaccagcgttcctgagcttgctcggttcctcaacaaaagatatccccagtacaaagtccccactgagtttg
gagattttccgtccaaggccaaattgatcatctcttcggagaagcttatccaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggccaaggggttgctgcagaactag
back to top