ANR, ANR (gene) Fragaria chiloensis

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Fragaria chiloensis
Synonym anthocyanidin reductase
Description NA
Comment ANR
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRHM026188.1-ANR.m1Fragaria chiloensismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRFragaria chiloensisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM026188.1-ANR.m1 LG5:67799..68686
HM026188.1

Sequence(s):
>HM026188.1-ANR.m1543
acaactgccaagccacctacttggggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttgctgaaga
aaacaacattgatctcatcactgtgatcccttctctcatggctggtgcttctctcactccagacatccccagcagtatag
gcctcgccacgtctttaattacgggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccata
tccattacacatgtggaggatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatg
ctgtgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagatatcccgaatacaaagtcccgactgagt
ttggagattttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggaggggttcactttcaagtacggg
attgaagacatatatgaccaaactgtggagtacttgaaacttaagggggtgctgcagaactag
back to top