ANR, ANR (gene) Fragaria x ananassa

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Fragaria x ananassa
Synonym anthocyanidin reductase
Description NA
Comment oxidoreductase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRDQ664193.1-ANRFragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRJX271492.1-ANR.m1Fragaria x ananassamRNA
ANRDQ664193.1-ANR.m1Fragaria x ananassamRNA
ANRDQ664192.1-ANR.m1Fragaria x ananassamRNA
ANRDQ438979.1-ANR.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database DQ664193.1-ANR LG5:66911..68686
DQ664193.1
mRNA parsed from NCBI nr database JX271492.1-ANR.m1 LG5:66911..68595
JX271492.1
mRNA parsed from NCBI nr database DQ664193.1-ANR.m1 LG5:66911..68686
DQ664193.1
mRNA parsed from NCBI nr database DQ664192.1-ANR.m1 LG5:66911..68686
DQ664192.1
mRNA parsed from NCBI nr database DQ438979.1-ANR.m1 LG5:66911..68686
DQ438979.1

Sequence(s):
>DQ664193.1-ANR1684
atggccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcggcggcaccggcttcgtgacgtctcagctgat
caagctcttgctagagaagggctatgccgtcagaaccactgttagagacccaggtcagaactatatcccctagcttcttc
agacctatattttggttttaccctatttttgcttagcttggaaaatggataagtactaggtataaagttttgaaatggat
gcataatatagttgtcagtcttatcacctagaagcttcattatgagctaggtgaggagggcattagtgaaatagttgagg
atctctaggaacgtactggggttaatctctctgtaaaattttagtaatgagagtaaaatttctgagtttagtgtgtatat
taattagctggtgtgaactgtgtattaatgtgtacatttttggcccagataatctgaagaagatctcccacctaacagca
ctacaagagttgggagagctaacaatatttcgtggggatttaaccgatgaagggagctttgatgctgctatagcaggttc
tgatcttgttttccatgtagccacaccagtccactttggctcgccggatccagagaacgacatgatcaagccaggagtcc
aaggagtactaaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttttgacatcatcagcagctgca
gtaactgtcaatactcttagtggaacaggcttgatcgccgacgaaaatgattggtctgatgttgagttcttgacaactgc
caagccacctacttgggtaatcaccaaattgtttcagtttcaagagtatttgacttgtgtaattgatgctagacaaaagg
cctacattgaaataaatgaaccaggtgacaaaggttttttttccctcaaatttgcagggatatcctgtttcaaaggtact
agctgagaagacagcatggaaatttgctgaagaaaacaacattgatctcatcactgtgatcccttctctcatggctggtg
cttctctcactccagatatccccagcagtataggcctcgccacgtctttaattacaggtatcaaaccatgccacaagcta
gaatatgttgtccattgctttaacttagttacttaaggccttacagcttgaatgaaaagtaatatgcgctgcggccttcc
aatgatcctttttgactctttcaggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccata
tccattacacatgtggaggatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatg
ctgtgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagatatcccgactacaaagtcccgactgagt
aagttttctattcaaagggaatagccctttaagactatggctgaacttacagaaggcttgaagtgcatttcattttgtta
taatccttttgcaatgcaggtttggagattttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggag
gggttcactttcaagtacgggattgaagacatatatgaccaaactgtggagtacttgaaacttaagggggtgctgcagaa
ctag
back to top
>JX271492.1-ANR.m1927
atgtccaccacccaacccatcatctcaaccaagtctgcttgtgtcatcggcggcaccggcttcgtggcgtctcagctgat
caagctcttgctagagaagggctatgccgtcagaaccactgttagagacgcagataatctgaagaagatctcccacctaa
cagcactacaagagttgggagagttaacaatatttcgtggggatttaaccgatgaagggagctttgatgctgctatagca
ggttctgatcttgttttccatgtagccacaccagtccactttggctcgccggatccagagaatgacatgatcaagccagg
agtccaaggagtactaaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttttgacatcatcagcag
ctgcagtaactgtcaatactcttagtggaacaggcttgatcgccgacgaaaatgattggtctgatgttgagttcttgacc
actgccaagccacctacttggggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttgctgaagaaca
caacattgatctcatcactgtgatcccttctctcatggctggtgcttgtctcactccagacatccccagcagtataggcc
tcgccacgtctttaattacaggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccatatcc
attacacatgtggaggatgtctgccgagctcagatatttttggcagagaaagaatctgcttctggtcggtacatatgctg
tgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaagatatcctgactacaaagtcccgactgagtttgg
agattttccatccaagcgaagaccatacttctcttcagaaagcttaa
back to top
>DQ664193.1-ANR.m11020
atggccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcggcggcaccggcttcgtgacgtctcagctgat
caagctcttgctagagaagggctatgccgtcagaaccactgttagagacccagataatctgaagaagatctcccacctaa
cagcactacaagagttgggagagctaacaatatttcgtggggatttaaccgatgaagggagctttgatgctgctatagca
ggttctgatcttgttttccatgtagccacaccagtccactttggctcgccggatccagagaacgacatgatcaagccagg
agtccaaggagtactaaacgttatgaaatcatgtgtgaaagcaaaaacagttaagcgagtcgttttgacatcatcagcag
ctgcagtaactgtcaatactcttagtggaacaggcttgatcgccgacgaaaatgattggtctgatgttgagttcttgaca
actgccaagccacctacttggggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttgctgaagaaaa
caacattgatctcatcactgtgatcccttctctcatggctggtgcttctctcactccagatatccccagcagtataggcc
tcgccacgtctttaattacaggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccatatcc
attacacatgtggaggatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatgctg
tgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagatatcccgactacaaagtcccgactgagtttg
gagattttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggaggggttcactttcaagtacgggatt
gaagacatatatgaccaaactgtggagtacttgaaacttaagggggtgctgcagaactag
back to top
>DQ664192.1-ANR.m11020
atggccaccacccaacccatcatctcaaccaagtctgcttgtgtcatcggcggcaccggcttcgtggcgtctcagctgat
caagctcttgctagagaagggctatgctgtcagaaccactgttagagacccagataatctgaagaagatctcccacctaa
cagcactacaagagttgggagagctaacaatatttcgtggggatttaaccgatgaagggagctttgatgctgctatagca
ggttctgatcttgttttccatgtagccacaccagtccactttggctcgccggatccagagaacgacatgatcaagccagg
agtccaaggagtactaaacgttatgaaatcatgtgtgaaagcaaaaacagttaaacgagtcgttttgacatcatcagcag
ctgcagtaactgtcaatactcttagtggaacaggcttgatcgccgatgaaaatgattggtctgatgttgagttcttgaca
actgccaagccacctacctggggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttgctgaagaaaa
caacattgatctcatcactgtgatcccttctctcatggctggtgcttctctcactccagacatccccagcagtataggcc
tcgccacgtctttaattacaggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccatatcc
attacacatgtggaggatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatgctg
tgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagatatcctgaatacaaagtcccgactgagtttg
gagattttccatccaaggcgaagaccatactctcttcagaaaagcttaagaaggaggggttcactttcaagtacgggatt
gaagacatatatgaccaaactgtggagtacttgaaacttaagggggtgctgcagaactag
back to top
>DQ438979.1-ANR.m11020
atgtccaccacccaacccatcatctcaacaaagtctgcttgtgtcatcggcggcaccggcttcgtggcgtctcagctaat
caagctcttgctagagaagggctatgccgtcagaaccactgttagagacccagataatctgaagaagatctcccacctaa
cagcactacaagagttgggagagctaacaatatttcgtggggatttaaccgatgaagggagctttgatgctgctatagca
ggttctgatcttgttttccatgtagccacaccagtccactttggctcgccggatccagagaacgacatgatcaagccagg
agtccaaggagtactaaacgttatgaaatcatgtgtgaaagcaaaaacagttaaacgagtcgttttgacatcatcagcag
ctgcagtaactgtcaatactcttagtggaacaggcttgattgccgacgaaaatgattggtctgatgttgagttcttgacc
actgccaagccacctacctggggatatcctgtttcaaaggtactagctgagaagacagcatggaaatttgctgaacaaaa
caacattgatctcatcgctgtgatcccttctctcatggctggtgcttctctcactccagacatccccagcagtataggcc
tcgccacgtctttaatcacaggaaatgagttcctcataaatggcttgaaaggcatgcaaatgctatcaggttccatatcc
attacacatgtggaggatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatgctg
tgctgaaaatagtagtgttcctgaggttgcaaagttcctcagcaaaagatatcctgaatacaaagtcccgactgagtttg
gagattttccatccaaggcgaagaccatactcccctcagaaaagcttaagaaggaggggttcactttcaagttcgggatt
gaagacatatatgaccaaactgtggagtacttgaaacttaagggggtgctgcagaactag
back to top