ANR, ANR (gene) Malus x domestica

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Malus x domestica
Synonym anthocyanidin reductase
putative anthocyanidin reductase
Description NA
Comment ANR
MdANR
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRJX892956.1-ANR.m1Malus x domesticamRNA
ANRJX892950.1-ANR.m1Malus x domesticamRNA
ANRJX892953.1-ANR.m1Malus x domesticamRNA
ANRDQ099803.1-ANR.m1Malus x domesticamRNA
ANRDQ139835.1-ANR.m1Malus x domesticamRNA
ANRAY830130.1-ANR.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JX892956.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
JX892956.1
predicted genes from whole genome assembly JX892950.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
JX892950.1
predicted genes from whole genome assembly JX892953.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
JX892953.1
predicted genes from whole genome assembly DQ099803.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
DQ099803.1
predicted genes from whole genome assembly DQ139835.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
DQ139835.1
predicted genes from whole genome assembly AY830130.1-ANR.m1 Chr10:39619219..39622385
unanchored:2247781..2250563
unanchored:2240426..2243592
AY830130.1

Sequence(s):
>JX892956.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttggcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcactccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatagccctgaaaggtatgcaaatgctatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccctactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top
>JX892950.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttggcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgtcgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttggggataccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcactccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top
>JX892953.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctactgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttcgcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcaccccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top
>DQ099803.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctactgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttggcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcactccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgttatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaagtag
back to top
>DQ139835.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctactgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacgaccgcaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttcgcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcaccccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top
>AY830130.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccgggttcgtggcgtctctgctggtcaa
gctactgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttcgcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgaaggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactaat
gtaaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcaccccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attgcacatgtggaggacgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacaccggcgttcctgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtctgaggccaaactgatcatctcttcagagaagcttatcaaggaggggttcgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top