ANR, ANR (gene) Prunus avium

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Prunus avium
Synonym anthocyanidin reductase
Description NA
Comment anthocyanidin reductase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRGU938697.1-ANRPrunus aviumgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRGU938688.1-ANR.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database GU938697.1-ANR N/A GU938697.1
mRNA parsed from NCBI nr database GU938688.1-ANR.m1 N/A GU938688.1

Sequence(s):
>GU938697.1-ANR1747
attactgaatagggcactatagagtctatatagaaactatttggattcaaacactactacataaacttttcaaattgtaa
aaggaagaactgttttggtcctatatctatgattaccctctgcccacaagttgtgtttgatgatattatttggcttgtat
gaagattgctgctgtcatgttttcagagtgatgattgttcattcttccattcatctttctgatattgttttttgactgtg
atgttaacattttctctgaacatatgatcagaaaggagaggtagtagaatcatctctatggttgttggttatgacttata
gcatgaccgttgtctctgtttgcacagaatttgttgaagatgttgatctgctgattagaagggccgagagatgcttagaa
gcaggggctgacatgataatgattgatgctgatgatgtctgtaaacaagctgattcaatgcgggcagacataattgcgaa
gatcattgggcgtcttggtgttgagaagaccatgtttgaagcatcaaatccaagaacatcagagtggtttgtcatacagt
atggtccaagggtataatgctctttcataaacttttacataatttcttttattgggaaaatgtgttgcatgtcattatat
ccttcttgtttgcctgaattttcaggtgaatctgtttgtggatcactcacaagtgatggatctggagtgcctccggggac
gaagcttaggtaaaaaccatacatctgtgctgggttcctcgtattttctgttctgaactttttgtaataagaagggggag
aaagttatggtaatatgcgtatgtgtctcttgttggatctggtcgtgttgtcttatgaatttgtgctgttgatgtaactt
tgttcaatataacctttgttccagtgtgtaaaacattaccttttaagattttgagaatcattgttgcaactgatctccac
tcttgaaactcatgacttttgtctcctcacaccaagttgaaattcaatgatgtatttgtattacaatccagtacttatga
tatttccaccaacaattgtattcttttatttttgtaaatgcatggtgcatgaagttcagtggccaaagctgcaaggaaga
agttcatatacgcacgatgttgtatataggcaacaaatataaagcattatattatagtatcgatcttgagaaaaaatttt
aaaaataaaataatgacggattgacaagtgaggtcggtttcagacccaaaaaaaaatataaaaaaaagaagtgatatccg
taattcttctcgtagctacgacgtcgcgcgtgcgggtgcccaatgcccagctaacacctgaatatctaactcaatctaaa
caagtggcccaacagctcataatctcggaatgaaaatagtcttatgttgtttcttttcttttaacgtagttaattgaatt
ttttatttaaaggtgaagctttatgtggtaaggaaaaaactcctttgacttggacaaacaaagaaatatatgttgtttgt
ttcagagactctgcaccaaacactaagaaagaaaaagaaaatgtgttttgagttggtggtgcatagatcatcacgtgctc
accttcttcctccagactcaattagatggagatgagcagcttctagtctatttaagaagtaaacatccgttgacagaaat
accagtctcataattccttctagtcctaaccaccagtgaactctgaaacttagcaactgaaagagcc
back to top
>GU938688.1-ANR.m11017
atggccacccaacccatctcaaagaagacagcctgtgtgatcggaggtacagggttcgtggcatctttgctggtgaagct
gttgctagagaagggctatgcggtcaaaaccactgtcagagaccctgacaatcagaagaagatctctcacctcacagcac
tacaagatttgggtgaactagaaattttaggagcagatctaactgatgaagggagctttgatgcccccatagcaggttgt
gaccttgttttccatgttgccacgcctgtcaacttcgcctctgaggaccctgagaaggatatgattaaaccagcagttca
aggggtgcaaaacgttcttaaagcatgtgtgaaagccaaaacagttaaacgcgttgttttgacatcatcagcagctgcag
tgtcgatcaacacacttaatggaacaggtttggtcacagacgagaacgattggagtgatgtcgagttcttgagtactgca
aagccacctacttggggctatcctgcctccaagacactagccgagaagacagcttggaaatttgccaaagaaaacaacat
tgacctcatcaccgtcatcccttctcttatggctggttattctctcactccggacgtccccagcagtatcggcctagcca
tgtctttaattacaggaaatgacttcctcataaatcatgccttgaaaggtatgcaactactatcaggttcaatctccatt
acacatgtggaggatgtctgccgggctcatatatttttggctgagaaagaatctgcttctggtcggtatatatgctgcgc
tgtcaataccagtgttcctgagcttgcaaagttcctcaacgaaagataccctgagtacaaagtccccactgagtttggag
attttccctcaaaggccaagttgatcctctcttcggagaagcttatcaaggaggggttcgactttaagtacgacattgaa
caaatatatgaccaagctgtggactacttcaaggctaaggggctgctgcagaactag
back to top