ANR, ANR (gene) Pyrus communis

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Pyrus communis
Synonym anthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRJX403955.1-ANR.m1Pyrus communismRNA
ANRDQ251189.1-ANR.m1Pyrus communismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRPyrus communisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX403955.1-ANR.m1 N/A JX403955.1
mRNA parsed from NCBI nr database DQ251189.1-ANR.m1 N/A DQ251189.1

Sequence(s):
>JX403955.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccggtttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgaactagagattttagcaggagatctaactgatgaagggagcttcgatgccccaatagctggc
tgtgatcttgttttccatgttgcaacccctgtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcatcagctgcta
cagtttcgatcaatacacttgacggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactact
gtcaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagaaaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcactccagacgttcccagcagtatcggccttg
caatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attacacatgtggaggatgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacactggcgttcctgagcttgcgaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtccaaggccaaactgatcatctcttcagagaagcttatcaaggaggggtttgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top
>DQ251189.1-ANR.m11020
atggccacccaacaacccatctcaaagaagacggcttgcgtcgtcggcggaaccggtttcgtggcgtctctgctggtcaa
gctgctgctccagaagggctacgccgtcagaaccaccgtcagagaccctgacaaccacaagaaggtctcccacctcacag
cactacaagagttgggtgagctagagattttagcaggagatctaactgatgaagggagcttcgatgccccaatagcaggc
tgtgatcttgttttccacgttgcaaccccagtcaactttgcctcacaggacccggagaatgatatgatcaaaccagcaat
ccaaggggtactaaatgttctgaagtcgtgcgtgaaagccaaaacagttaagcgcgttgttttgacatcgtcagctgcta
cagtttcgatcaatacacttgacggaacaggtttggtcgtggatgaaaaggattggagtgatttggagttcttgactact
gtcaagccacccacttgggggtaccctgcctccaagacactagctgagaagacagcttggaaatttgccgaagagaacaa
cattgatctaatcactgtgatcccttctcttatggccggtccttctctcactccagacgttcccagcagtatcggccttg
ccatggctttaatcacaggagatgatttcctcataaatatggccctgaaaggtatgcaaatgctatcaggttcgatatcc
attacacatgtggaggatgtctgccgggctcatatatttttggctgagaaagaatctgcatctggtcggtacatttgctg
tgctgccaacgctggcgttcccgagcttgctaagttcctcaacaaaagatacccccagtacaaagtccccactgagtttg
gagattttccgtccaaggccaaactgatcatctcttcagagaagcttatcaaggaggggtttgattttaagtatggcatc
gaagaaatatatgaccaaactgtggagtacttcaaggcaaaggggctgctgcagaactag
back to top