ANR, ANR (gene) Rosa roxburghii

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Rosa roxburghii
Synonym anthocyanidin reductase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRJQ041640.1-ANR.m1Rosa roxburghiimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRRosa roxburghiigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ041640.1-ANR.m1 N/A JQ041640.1

Sequence(s):
>JQ041640.1-ANR.m1712
ggacccggagaatgatatgatcaagccaggagtccaaggggtactaaatgttctgaaatcatgtgtgaaagcaaaaacag
ttaagcgagttgttttaacatcatcagcagctgcagtaactgtcaatactcttagtggcacaggcttgattgcggacgaa
aatgattggtctgatgttgagttcttgaccactgccaagccacctacttgggggtatcctgtttccaaggtactagctga
gaagacagcttggaaatttgctgaagaaaacaacattgatctcatcactgtgatcccttctctcatggctggtgcttctc
tcactccagacatccccagcagtataggcctcgccacatctttaattacaggaaatgaattccttataaatggcttgaaa
ggcatgcaaatgctatcaggttccatatccattacacatgtggaggatgtctgccgtgctcatatctttttggcagagaa
agaatctgcttccggtcggtacatatgctgtgctgaaaatagcagtgttcccgaggttgcaaagttcctcagcaaaagat
atcccggctacaaagtcccgactgagtttggagattttccatccaaggccaagaccatactctcttcggaaaagcttaag
aaggaggggttcactttcaagtgtgggattgaagacatttatgaccaagctgtggagtacttcaaggcaaag
back to top