ANR, ANR (gene) Rubus hybrid cultivar

Gene Overview
Name ANR
Gene Symbol ANR
Type gene
Organism Rubus hybrid cultivar
Synonym ANR
anthocyanidin reductase
Description NA
Comment anthocyanidin reductase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRJQ068825.1-ANR.m1Rubus hybrid cultivarmRNA
ANRKR732618.1-ANR.m1Rubus hybrid cultivarmRNA


The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ANRKR732618.1-ANRRubus hybrid cultivargene


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anthocyanidin reductaseANRRubus hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JQ068825.1-ANR.m1 N/A JQ068825.1
gene parsed from NCBI nr database KR732618.1-ANR N/A KR732618.1
mRNA parsed from NCBI nr database KR732618.1-ANR.m1 N/A KR732618.1

Sequence(s):
>JQ068825.1-ANR.m1570
ccagagaacgatatgattaaaccaggagtccaaggagtactaaacgttctgaaatcatgtgtcaaagccaagacagtcaa
acgcgtcgttttgacatcatcagcagctgcagtgactgtcaatactctcactggaacaggcttgatcgtggacgaaaatg
attggtctgatgttgagttcttgaccactgccaagccacctacttgggggtatcctgtttccaaggtactagctgagaag
acagcttggaaattcgccgaagaaaataacattgatctcatcactgtgatcccttctctgatggctggtgctagtctcac
tccagatatccccagcagtattggcctcgccacgtctttaattacaggtaagaaatcaggaaatgaattcctcataaatg
gcttgaaaggcatgcaaatgctatcaggttctatatccattacacatgtggaagatgtctgccgagctcatatatttttg
gcagagaaagaatctgcttctggtcggtacatatgctgcgctgcaaatagcggtgttcctgagcttgcaaaatttctgaa
caagagatac
back to top
>KR732618.1-ANR1738
atggccacccgccaacccatcatctcaaacaagactgcttgtgtgatcggtggcaccggcttcgtcgcgtctctgctgat
caagctcttgctagagaagggctatgccgtcaaaaccacagctggagaccctggtcagaacttcttcatttatctgacaa
actcaacctataatatttggcttaccctatttttgcttatgttttctttaatatttctcatcgatcatatgcttttggaa
caccaacaaaatatagtaatgcatgttgtaacagaaaaacaattaacaacaaaagacactaattgacatacacaaatggt
gtgatattgaggacttagaattaggtttttaaccccgggtcaatgtaaacagtctctgttaaattttatttcccagagta
ataaatttctgattttagtgtgtatattatggtggtgtgaagtctgtctttcattttgtacatttgggcacagataatca
gaagaagatctcccacctcatagcactacaagctttgggagacctaacgatttttcgaggtgatttaaccgatgaaggta
gcttcgatgctgcgattgcgggatctgacattgttttccatgttgccacacctgtccactttggctcgcaggacccggag
gtacataatattcgtagaaattgcttagctaaaaattgcatttggtcatatagttttgctgcagcttaagcacaatgtac
tttcttccctttccaatatccagaatgacatgatcaagccgggagtccaaggagtactaaacgttatgaaatcatgtgtc
aaagccaagacagtcaaacgtgtcgttttgacatcatcagcagctgcagtgactgtcaatactctcactggaacaggctt
ggtcgtggacgaaaatgattggtctgatgttgagttcttgaccactgccaagccacctacttgggtaaatcacataattg
tttttgtctataagatgaaatgttttctgaaataaatgaactaggtgatcaaactaaaacttttcctcaaatgttcaggg
gtatcctgtttccaaggtactagctgagaagacagcttggaaattcgccgaagaaaacagcattgatctcatcactgtga
tcccttctctgatggctggtgctagtctcactccagatatccccagcagtattggcctcgccacgtctttaattacaggt
aagaaatcagaaggtggaatatgttacatgtccatattagcaccgcggtgttctaatggtactcttttacaggaaatgaa
ttcctcataaatggcttgaaaggcatgcaaatgctatcaggttctatatccattacacatgtggaagatgtctgccgagc
tcatatatttttggcagagaaagaatctgcttctggtcggtacatatgctgcgctgcaaatagcggtgttcctgagctag
caaagttcctgagcaaaagatatcccaactaccaagtccccactgagtaagccctccctttaacccaatgactcagcttg
cagaaaaacttgaactgcacctcatttagttattgctacattacagatagttactctacttttgcaattgcaggtttgga
gattttccgaccaaggccaagaccataatctcttcggaaaagcttaagaaggaggggttcactttcaagtacgagattga
agacatatatgaccaagctgtggagtacttgaaggctaagggggtgctgcagaactag
back to top
>KR732618.1-ANR.m11020
atggccacccgccaacccatcatctcaaacaagactgcttgtgtgatcggtggcaccggcttcgtcgcgtctctgctgat
caagctcttgctagagaagggctatgccgtcaaaaccacagctggagaccctgataatcagaagaagatctcccacctca
tagcactacaagctttgggagacctaacgatttttcgaggtgatttaaccgatgaaggtagcttcgatgctgcgattgcg
ggatctgacattgttttccatgttgccacacctgtccactttggctcgcaggacccggagaatgacatgatcaagccggg
agtccaaggagtactaaacgttatgaaatcatgtgtcaaagccaagacagtcaaacgtgtcgttttgacatcatcagcag
ctgcagtgactgtcaatactctcactggaacaggcttggtcgtggacgaaaatgattggtctgatgttgagttcttgacc
actgccaagccacctacttgggggtatcctgtttccaaggtactagctgagaagacagcttggaaattcgccgaagaaaa
cagcattgatctcatcactgtgatcccttctctgatggctggtgctagtctcactccagatatccccagcagtattggcc
tcgccacgtctttaattacaggaaatgaattcctcataaatggcttgaaaggcatgcaaatgctatcaggttctatatcc
attacacatgtggaagatgtctgccgagctcatatatttttggcagagaaagaatctgcttctggtcggtacatatgctg
cgctgcaaatagcggtgttcctgagctagcaaagttcctgagcaaaagatatcccaactaccaagtccccactgagtttg
gagattttccgaccaaggccaagaccataatctcttcggaaaagcttaagaaggaggggttcactttcaagtacgagatt
gaagacatatatgaccaagctgtggagtacttgaaggctaagggggtgctgcagaactag
back to top