AOS1, AOS1 (gene) Fragaria x ananassa

Gene Overview
Name AOS1
Gene Symbol AOS1
Type gene
Organism Fragaria x ananassa
Synonym allene oxide synthase
FaAOS1
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
AOS1AB617727.1-AOS1Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
AOS1AB617727.1-AOS1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
allene oxide synthaseAOSFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AB617727.1-AOS1 N/A AB617727.1
mRNA parsed from NCBI nr database AB617727.1-AOS1.m1 N/A AB617727.1

Sequence(s):
>AB617727.1-AOS1457
tgacaagctcaagcgcttaatgttctatcttttaaaatccggtatcaagtctgtgatccccgagtttcactccagctact
ccgagcttttcgaaactcttgaaactaagctcgctgacaagggtaaggccagcttcaacgaagccaacgatcaagctgct
ttcaatttcttggctcgatcactctacggaactagtccatcaaatacccaactcggcaccgacggtcctaaattggtccg
gaaatgggttctcttccaactgagtccaattctagttcttggtcttcccaagttcattgaagatcctctgattcacactt
tccctctgccaccgtttttggtcaagaaagactaccagagactctacgacttcttctaccagtcatcaggccacgtgctc
gacgaggctgagcggctgggagtgtcaagagacgaagcgtgtcacaatctactattc
back to top
>AB617727.1-AOS1.m1457
tgacaagctcaagcgcttaatgttctatcttttaaaatccggtatcaagtctgtgatccccgagtttcactccagctact
ccgagcttttcgaaactcttgaaactaagctcgctgacaagggtaaggccagcttcaacgaagccaacgatcaagctgct
ttcaatttcttggctcgatcactctacggaactagtccatcaaatacccaactcggcaccgacggtcctaaattggtccg
gaaatgggttctcttccaactgagtccaattctagttcttggtcttcccaagttcattgaagatcctctgattcacactt
tccctctgccaccgtttttggtcaagaaagactaccagagactctacgacttcttctaccagtcatcaggccacgtgctc
gacgaggctgagcggctgggagtgtcaagagacgaagcgtgtcacaatctactattc
back to top