ASG1, ASG1 (gene) Malus x domestica

Gene Overview
Name ASG1
Gene Symbol ASG1
Type gene
Organism Malus x domestica
Synonym anther-specific protein ASG1
Description NA
Comment anther specific gene; MdASG1
MdASG1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG1AY461513.1-ASG1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG1AF403122.1-ASG1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anther-specific protein ASGASGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY461513.1-ASG1 Chr12:20945823..20946299
chr12:18420063..18420539
AY461513.1
predicted genes from whole genome assembly AF403122.1-ASG1.m1 Chr12:20945595..20945823
chr12:18420539..18420767
AF403122.1

Sequence(s):
>AY461513.1-ASG1477
aaatctcaggaaccaaaattatgtgttatgcaaatctcagagaccattttgactaaaaagccttcatcttattaagttgt
taatcatcgtttgttaaattcctttgcacttttctatggacttaaaatattcatgctatgaccctcacatacaatgatac
aaaaatacggatgaatattgttcataaatcctcctataatcttgacattcattacttaatttgttagtttgttataccta
tgcatgtaggcgttgttcatgcaaaatcatacacgtacgtactaacccttccaaacctcacacaaaatccaacaatttca
tacctaaaataacaaaacctcgtccatagaaagctatatttacctccctctgccgtcctatcttcctcaggacatctaca
gacttctacaagcctcttaacattccaattgcaaggcgtgttttcgatccatcgaccgactacacgccgcccacaaa
back to top
>AF403122.1-ASG1.m1228
atggccatgaagaagattgccttgattgtcctcgtggttgctgtttgcatgtctgcagctatggccgttgcacctctaaa
ggctgcagctgccaccccagctgccagtcccgctgcaacgcccacctccgatgcttctgctccagtacctaatggaagca
atatgaacgccgttggatctctagtcggagcttcagtcttgtccttcttggccctttacttgcattga
back to top