ASG2, ASG2 (gene) Malus x domestica

Gene Overview
Name ASG2
Gene Symbol ASG2
Type gene
Organism Malus x domestica
Synonym anther-specific protein ASG2
Description NA
Comment anther specific gene; MdASG2
MdASG2
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG2AY461514.1-ASG2Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG2AF403123.1-ASG2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anther-specific protein ASGASGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AY461514.1-ASG2 Chr03:2000438..2003307
chr3:2300412..2303283
chr3:2475227..2478098
AY461514.1
predicted genes from whole genome assembly AF403123.1-ASG2.m1 Chr03:2000171..2000438
chr3:2303283..2303550
chr3:2274794..2275062
chr3:2474960..2475227
AF403123.1

Sequence(s):
>AY461514.1-ASG22874
aaagtttcgaattttcttgttgtagtgatataatttcagtgttgaattctttagtttttcaattcaataatgccattaat
tgggaatggcgacacgtcgaaattgaaattcttggcaggagttgtatgaatctgataactttgtgaatttgaattcgaga
tgtttcatattgttgagaacagagagatgaatgtggtttcttctcctttgtgttacattcaagatcttttagcaacacgg
atcgctgatttgttatgaattgtctgaacagtttgttttcgtggcatacattttggtttctttgaagcatttgttgtgtt
gtaatagtatgaattgtttgagcatagtctggattacacactaagctacttctcagaatttgtgagtgtgcatatttgta
gaacctaacttcctaccctctaaatgtctaaggtttagcttcccgcactctgtactatggaggctgggcaccacccgcca
ttaagaagttgaatttaggtccaacccgaacttgaaactctagaaatacttggccaaagttattggttatagaacataga
aatcattcaacaagatatggatgttggcggttgtttttttcgacaacccaccttcaaggattagttattgctggatgatg
agttaagaggatcaacaaaagccgaaatatttgtactgattcttggttgagctctaacaatggcaaaggctgtgtaggag
attcttgtatactggctacagtgtggtagccatatatacagtgtggtagcgatgtagtggaatttcttgttgtcgagacc
aatggcgattctaaacttgtaggggatcagaaagatccgaaatatttgagatcaacaagaagttagaattgctattggtc
tacacaacgggaaattcaagtaagaattcccctacacgacaccattgccattgttagaatatgaatactttaggatggta
gattttaacattctcgagtggacttcggctgcaagttctgctgttacctgcccgtaggttatgaacttgtgagtaggcat
gtcaaatgtaaagtaggcattgcgtctaagttagcttctgaacttcaaattaattggtagaacattgttttcaagtggtt
aatcaaaataccaatcaactttttgaggcttgtatacgctgtcagatcgggccaaagagatggccatggccgctacactg
cggccgttggcgctagaaatgcaaatttgaaggccaaaaatagcacattcagaccagtactgtattatatattgggatga
agcgatatacaaccataacaaatgatgaaatccactctccaaaaggatacagaaaataccacaataatcaaatagcaatc
tcagtctcaaatctccctaatgccgcagcagcgcaaagaaagagaggagcaacgaagagtaaacaaaagcgccggaaatg
gtcactggaactccggctccagcgtccaatgcaggtgatggtgctggcgcgctatcctgagctgtaactgagacgagcac
aatggcgattaccatcacgaacacagctttgcagatgctaacttgcgccattctagagagaggaacaaagaatggattga
gcgaactgcgagggagggagggagagagggagagagagagagagagagagagtgtgtgtgtccgtctgggttcaaggctg
agtgaataaggtgagggactgagggacatgtatttatagaccgttttaattttaattatttgtaattaaactttgaaact
tttcaaacaaaaatatgagtacgaggatggtaacgttactctcccgttatgtcctgtggccccacgattggaaggtgacg
tgtcagccttttgttccttttgtggtccccataacggctctattggtcggttgttgtctttgttgtatagggtggcaata
tctagaccgttgagtaaagaaacttcaaaaatgatgctttaccaaagaaaagatcaatgaaggaaaatgttttgttttca
catgaaagatttcttgattcaccgctaaagataggagtaaatatttggtagagctcacactgagtgaaatcttgtgaggt
cgagtgaaattttaatacaataatttgatgtttgacataaatattttacgaatgatatatgtgattggatatccttatcc
aagtttttcttcaaaaaagactactagttttcttctgtatttagaactataccaacatttcaagaaaataaagcacatac
tataaggatttaatttgtttaggtcttaagagaatcccacaataaattatacgaatttgatgcttaatagttctcaattt
gataaattaaggttgatgatctataaaatgttatgaattcgataatttaattatcaacggattcacattaggtcggttca
atttgaatgtgattcttgttgacgaatttaagtattagataatcattggctacacattagatgggacatatataagtgta
ctacaaaaacgtggcctttctcgcatttttcagtctgtaattatgcatggtattaccttcacatacaatggtacaaaata
cgtataaatattggtcatatcctcctatattcttggtatttattacttaattaatttgttagtttgttatacccatgcat
gtaggcgttgttcatgcaaaaccatacacgtacgtactaacccttccaaacctcaaacaacatccaacagatttcatccc
aaaaataacaaaatcctcctccatagaaagctatatatacctcccactgccctcctatattcctcaggacagctacaaac
ttctacaagcctcttaacattcctattgcaaggtgtgttttcgattcattgaccgaccacacgccgctcgcaaa
back to top
>AF403123.1-ASG2.m1267
atggccatgaagaagattgccttggttgtcctcgtagttgccgtctgcatcagcgcagcaatggctgctgcacctgtaaa
gggcgccgcagccaccacctctgcagccacccccactgcagccaccaccgctgcagccacccccgccgctgcagccacag
ctggccctgtagcttctactccagcacctaatggaagtagcatgaacgccgttggatctctggttggagcttcactcttg
tccttcttggccatttacttgaactaa
back to top