ASG3, ASG3 (gene) Malus x domestica

Gene Overview
Name ASG3
Gene Symbol ASG3
Type gene
Organism Malus x domestica
Synonym anther-specific protein ASG3
Description NA
Comment anther specific gene; MdASG3
MdASG3
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG3AY461515.1-ASG3Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG3AF403124.1-ASG3.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anther-specific protein ASGASGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AY461515.1-ASG3 chr11:2885945..2887500
chr11:2885609..2887160
chr11:3285946..3287501
AY461515.1
predicted genes from whole genome assembly AF403124.1-ASG3.m1 Chr11:2571235..2571463
chr11:2885717..2885945
chr11:2885381..2885609
chr11:3285718..3285946
AF403124.1

Sequence(s):
>AY461515.1-ASG31547
atctagaccgttgagtaaagatagtttaacaatgatgctttaccaaagaaaataaaagaaagaagaaaagtgtcaacttg
ttttcacttccaagatttctccatgggagattttatttaaaggaaaaataaagaaaattgtttgaaaattttgagtttta
acaataaggataaaataaaaggtaaaataaatagtctcatgtttgactttttaatgtaaaaatgtgatttttagttaaag
tgaatagtaccgtgagtttttcgttaaaactcgatttatttaaattattttactctacagtcaactttgtatttacattc
aaccaccacagggtggcaggttgaggacgaattttagattcgtatttcacacggtatgttttaagttcgattattagctc
tagtgaatttcacaatggtgctcaagggaaggataaaatgcctcagtgagtcttcccgacatccgaaatggtggattgtt
acgacaaatctgtcaagtggtcccttttttttctttaaaaaaaataaaataaaaaaaaacttagtattctaccactagcg
tggttgaatactcttacctaagttttccttcaaaaattacttatagttatataagacaaacatttcaagaaaattaagca
cgtactattaagaaatttaatttgtttaggtgttaagataatccaacattaacttatacggatttgatgcttattaggtg
tcaatttgataaaataaggttgatgatctaaaaatgccatgagttcgataatttgatgataaatgattcacattaggtgg
atccaatttgaatgtgatccttttatgggtttattggtgacggagttaagtttttacacttgccacatcagatagctaca
taattgtagcacaagaatgtgatctctttagcaattttttttcaatatgtaattatgcatgctattaccctcacatacag
caacacaacactaagtgaggtcggttctacgaattctaggacatcattggatcagttttgcaccatgactttcgttagtt
ccaagtactctatattttttcataaagttaatttccaagtctttttaggttttcatctaccctttttgcgccgagtctct
atcttatagttgcatcttctaaccagaacatctgtgagtcttaattcatgtgttcaaaccaccttacctgattttctttc
atattaccctcacatacaatgatacaaaaatgggtatgaatattgttcgtaaatcctcccataatcttgacatttattac
ttaatttgttagtttgttatacccatgcatgtaggcgttgttaatgcaaaaaccatacacgtacgtattaacccttccaa
acctcacacaaaatccaacagatttcatcccaaaaataacaaaaccctcctccgtcgaaaactatatatatctccgtctg
ccctcctatcttcctcaggacagctaccgacttctacaagcctctcctaacattccaattggaaggcttgttttcgatcc
atcgacggaccacacgccacccgcaaa
back to top
>AF403124.1-ASG3.m1228
atggccatgaagaagattgccttggttgtcctggtggttgctgtctgcatgtccgcagctatggcagctgcacctctaaa
ggctgcagctgctaccccagctgccacccctgcggcagctcccgtctccgatgcttctgttccagcacctaatggaagca
acatgaacgccgttggatctctgatcggagcttcagtcttgtccttcttggccctttacttgcactaa
back to top