ASG4, ASG4 (gene) Malus x domestica

Gene Overview
Name ASG4
Gene Symbol ASG4
Type gene
Organism Malus x domestica
Synonym anther-specific protein ASG4
Description NA
Comment MdASG4
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
ASG4AF403125.1-ASG4.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
anther-specific protein ASGASGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly AF403125.1-ASG4.m1 Chr03:2000171..2000438
chr3:2303283..2303550
chr3:2274794..2275062
chr3:2474960..2475227
AF403125.1

Sequence(s):
>AF403125.1-ASG4.m1267
atggccatgaagaagattgccttggttgtcctcgtagttgccgtctgcatcagcgcagcaatggctgctgcacctgtaaa
gggcgctgcagccaccacctctgcagccacccccactgcagccaccaccgctgcagccacccccgccgctgcagccacag
ctggccctgtagcttctactccagcacctaatggaagtagcatgaacgccgttggatctctggttggagcttcactcttg
tccttcttggccatttacttgaactaa
back to top