BG1, BG1 (gene) Fragaria x ananassa

Gene Overview
Name BG1
Gene Symbol BG1
Type gene
Organism Fragaria x ananassa
Synonym beta-glucosidase 1
Description NA
Comment plays a role in fruit ripening
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BG1KF697198.1-BG1.m1Fragaria x ananassamRNA
BG1JX244261.1-BG1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-glucosidaseBGFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KF697198.1-BG1.m1 N/A KF697198.1
mRNA parsed from NCBI nr database JX244261.1-BG1.m1 N/A JX244261.1

Sequence(s):
>KF697198.1-BG1.m11512
atggggtggaagagaggcattgctttgtttattgcttttcaggtgattattgggtgttcatcagagtctaattcagagat
taacagaggcagctttccaaagggctttgtttttgggactgcttcttctgccttccagtatgaaggcgcagtaaaagagg
atggaagggggccttctgtatgggacattttttcacacacttttggtaaaataactgatttcagtaatgctgatgttgct
gtggatcagtatcacctttatgatggagatgtgcaactaatgaaggatatgggaatggatgcttataggttttcgatatc
ctggtctcggatattccccaatggaactgggcaaatcaatcaggcaggggttgatcactacaacaatctcattaattcat
tgctagcgaaaggaattgaaccgtacgtaaccctctaccactgggatcttcctcaagccttggaagacagatacactggg
tggcttgacgctcaaatcataaaggactttgcagtatacgcggagacatgctttcagaaattcggtgacagggtgaagca
ctggatcacattcaacgagccacacacatttgctgtacaaggatacgatgtaggtctccaggcaccaggaagatgctctc
tcctaggcagccttttctgtagggccggaaactctgcaactgagccttacatagttgctcataatgtcatcctttctcat
gcaactgttgccaacatttacaggaaaaagtataagtcaaaacaacgaggatcaattggggcatcatttgatgttatttg
gtatcgatcagcaacaaactctacagcagacattgaagcaactcaaagagcccaagattttcagcttggctggtttcttg
acccttttatttttggggattatccattctctatgagaagtagagtaggaagccggctgccaaagttttccaaatctgag
tctactttaatcaaggggtcattggattttgtgggcataaatcactacactaccttctatgccagtaatgattcttctca
tataatcggactactgaatgactccctatcagactctggtgccattacccttcctttcaaagatggaaaagctattggag
ataaggcaaattcgatatggttgtacatagtgcctgaggggatgagaagcttaacgaactacatcaagaaaatgtatggc
aatcctccggtgattatcactgagaatggcatggacgacccaaatagcccattcatttccctcaaggatgctctaaagga
tgagaaaaggatcagttaccaccgtgactatttgtcaaacttgctagcttcaatcaaagaagatgggtgcaatgtgaacg
gttattttgcatggtctctactggataactgggagtgggctgcaggatacacttcaagatttggtctctatttcattgac
tataaggacaagctcaagagataccccaaggactctgttcaatggttcaagaacttcttaacttcaacttga
back to top
>JX244261.1-BG1.m11848
atggggtggaagagaggcattgctttgtttattgcttttcaggtgattattgggtgttcatcacagtctaattcagagat
taacagaggcagctttccaaagggctttgtttttgggactgcttcttctgccttccagtatgaaggcgcagtaaaagagg
atggaagggggccttctgtatgggacattttttcacacacttttggcaaaataactgatttcagtaatgctgatgttgct
gtggatcagtatcacctttatgatgcaagacttctccaaccaatctcaggagatgtacaacttatgaaggatatgggaat
ggatgcgtataggttttcgatatcctggtctcggatattccccaatggaactgggcaaatcaatcaggcaggggttgatc
actacaacaatctcattaattcattgctagcgaaaggaattgaaccgtacgtaaccctctaccactgggatcttcctcaa
gccttggaagacagatacactgggtggcttgacgctcaaatcatacaggactttgcagtatacgcggagacatgctttca
gaaattcggtgacagggtgaagcactggatcacattcaacgagccacacacatttgctgtacaaggatacgatgtaggtc
tccaggcaccaggaagatgctctctcctaggccgccttttctgtagagccggaaactctgcaactgagccttacatagtt
gctcacaatgtcatcctttctcatgcaactgttgccgacatttacaggaaaaagtataagccaaaacaacgaggatcaat
tggggcatcatttgatgttatttggtatcgatcagcaacaaactctacagcagacattgaagcaactgaaagagcccaag
attttcagcttggctggtttcttgaccctttcatttttggggattatccattctctatgagaagtagagtcggaagccgt
ctgccaaagttttccaaatctgagtccactttaatcaaggggtcattggattttgtgggcattaatcactacactacctt
ctatgccagtaacgattcttctcatattatcggactactgaatgactccctatcagactctggtgccattgcccttcata
gtattttcgtcctgttttcagctttcaaagatggaaaagctattggagataaggcaaattcgatatggttatacatagtg
cctgaggggatgagaagcttaatgaactacatcaagaaaaagtatggcaatcctccggtgcttatcactgagaatggcat
ggacgacccaaatagcccattcatttccctcaaggatgctctaaaggatgagaaaaggatcagttaccaccgtgactatt
tgtcaaacttgctagcttcaatcaaagaagatgggtgcaatgtgaacggttattttgcatggtctctactggataactgg
gagtggggtgcaggatacacttcaagatttggtctctatttcattgactataaggacaagctcaagagataccccaagga
ctctggtttagccttgtcgagtttgttgccggacgggaattccatatgcccttttagtctcttgtatgtggttcagcttg
agtatagacggagatatttgagatttgctagtttgtgcagcgtggccgggaagatctacacgctttgtggaggcttggcg
tggccgtgggtttgcttgcagcaggcagtgatggaggcaggtggtggtggaggaggcagatcagatcacggatcatcttc
tgttgggcttgggctgagcctgatctttgaggttgtttgggcttccagatgggttagagctcgccatttgggccttaacc
ctttctag
back to top