BG2, BG2 (gene) Fragaria x ananassa

Gene Overview
Name BG2
Gene Symbol BG2
Type gene
Organism Fragaria x ananassa
Synonym beta-glucosidase 2
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BG2JX244262.1-BG2.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-glucosidaseBGFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database JX244262.1-BG2.m1 LG2:2492399..2498837
JX244262.1

Sequence(s):
>JX244262.1-BG2.m11053
atggggaagtggtggaacgacagcagtggatggagggatggtggatggaccagagaactggaggttccttgctggagcca
tgctttgataacagatgttggagcaaagaaccagagagtacgaacagaccgtggcgtgtcaatcaaccatttgggaggga
caggctctgtaaaaagcaccgcattgccttctatcttggatttttggctactgtacgcaagaatggccaagattgagttg
ttaaaggaatatgaacaagcagatgaaatctctcgcagagccttccctcctaacttcgtctttggcgttgccacctcggc
ctatcaggttgaaggtgcctgcagggagggcaacaggggtcctagtatctgggatgcttttacacacactaaaggcaaga
tcattgatggtagcaatggtgacattgctgtggatcaatatcaccggtataaggaggatgttgatctcattgccaagttg
ggatttgctgcttatcggttttccatatcatggtctcgaatctttcctgatggtctaggaaccactgtcaatgaagatgg
gattgcttactacaacaatatcattaatgctctcctggaaaaaggcatccaaccttatgtaacactgtaccattgggatc
taccattgtaccttcatgaaagtatgggagggtggttaaacaagcagattgtaaaattcttctcagtctatgcggacacc
tgcttcgcaaattttggcgatagagtaaaggattggatcacaattaatgagcctcttcaaacttctgtcaatggttatgg
ttacgggatatttgctcctggaagacatgaacatgcatctacagaaccatatttggttgcgcatcatcaactgttggccc
atgcagctgctgtttcaatataccgaagcaaatataaggacaagcaaggtggacaaataggcatagcagtggactgtgaa
tgggcagaggccaattcagataaaactgaagacaaaattgctgcagcaaggcgcttagattttcagcttggatggtattt
acttcttctctaa
back to top