BG, BG (gene) Malus x domestica

Gene Overview
Name BG
Gene Symbol BG
Type gene
Organism Malus x domestica
Synonym beta-glucosidase
Description glucoside synthesis
Comment glucoside hydrolase
amygdalin hydrolase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BGJN579689.1-BG.m1Malus x domesticamRNA
BGAY347841.1-BG.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-glucosidaseBGMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JN579689.1-BG.m1 Chr00:22051676..22054945
chr11:9245203..9248475
chr11:10045205..10048477
JN579689.1
predicted genes from whole genome assembly AY347841.1-BG.m1 Chr09:30997545..30997650
chr2:9092417..9092522
AY347841.1

Sequence(s):
>JN579689.1-BG.m11608
atggcaacgaagttgggctctttgctcttgtgtgtcttgctactcaatggctttgcattgacaaacaccaaagctgctaa
cccagatcgacccattgtctgtaactcacttgacaggaccaagtttgatgctctaaaaccagggttcgtctttggtgcag
cttcagcagcttaccaggtagaaggtgcatggaacgaagatggtagaggaccaagcatatgggacaccttcacccacaac
catccagaaaaaatcactgatcgcagcaatggagatgtcgccattgatcaataccacctctataagaaagatgtagcaat
tatgaaggatatgaagttggatgcttataggttctctatctcatggcccagattgttaccaaatggcacgctaagtgggg
gtgtcaacaggaaaggaattgaatattacgacaatctcatcaatgaactccttcgcaatggcatacaaccatttgtgaca
atctttcactgggatgttccccaagcgttagaagatgcatatggtggtttcttaagcgctagtattgtcgatgactttaa
agactacgcagaactttgtttttcactttttggtgatcgggtgaagcactggatcacgttgaatgagccatataccttca
gtaaccatgcatatacaatcgggatccacgcaccgggacgatgctctgcttggcaagacccaacctgcctcggtggagat
tcggctactgaaccctatttggtaacacaccaccaactccttgctcatgcagctgctgtaaaagtatacaaggataaatt
tcaggcatatcaaaatggggtgataggaataacactagtgtcacattggtatgagcctgcttcagatgcaaaggaagata
tagatgctgcaaatcgagctttggattttatgtttggatggtttatggatccaattacaagaggtgactacccgtacaac
atgcgatgccttgttagagaacgattgccaaaattcacggaagaagaatccaagatgttaactgggtcttttgattttgt
tggattgaactattattctgctagatatgcaactgatgtacctaagaattattctgaacctgcaagttacttatacgatc
cacatgttactacactgactgaacgtgatggcattcctattggtcctcaggctgcttcagactggttatatgtttatcca
aaaggaattcacgattttgtactctacacgaagaataagtatgatgatccaatcatttacattactgagaatggcgttga
tgaggtcaataattccaccttatcactcgacgatgccctctatgataccaataggactgactactacaatcgccacctct
gttaccttcaagcagcaatcaagaagggtagtaatgtgaaaggatactttgcatggtcaattttagacaactttgaatgg
agtgaaggctacacagttcgatttggtattaactatgtggattatgacaatggactccaaaggtacccaaaactttcgac
ctattggttcaaaaatttcctcaagaagcgcaaaggaagttcaaatattttggccgattatgttggagacactaagtctg
tgtattaa
back to top
>AY347841.1-BG.m1105
ggatatagtgttcggtctggtatcaattatgtggattacaacgacaaccaaaagaggtaccccaaactctcagcacactg
gttcaagagtttcctcaagtactga
back to top