BG, BG (gene) Prunus avium

Gene Overview
Name BG
Gene Symbol BG
Type gene
Organism Prunus avium
Synonym beta-glucosidase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BGU39228.1-BG.m1Prunus aviummRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
beta-glucosidaseBGPrunus aviumgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database U39228.1-BG.m1 N/A U39228.1

Sequence(s):
>U39228.1-BG.m11597
gctgcttctccttggctttgcattggcaaataccaatgctgccaggacagatccacccgttgtttgtgcaactctcaaca
ggaccaatttcgatactctttttccagggttcacatttggcacagctacagcatcttaccaattagaaggtgctgcaaac
atagatggtagaggaccaagcatatgggatgccttcacccacaaccatccagaaaaaatcaccgatggcagtaatggaga
tgttgctattgatcaatatcaccgatataaggaagatgtagcaattatgaaggatatggggttggatgcttataggttct
ctatctcatggtctagattgttacctaatggaacactaagtggtggaattaacaagaaaggaatcgaatactacaataat
ctcaccaatgaactcatacgcaatggtatagaaccactagtgacactctttcattgggatgttccccaagccttagaaga
agaatatggtggtgtgttaagccctcgtattgtctatgattttaaagcatacgcagaactttgttataaggaatttggtg
atcgagtaaaacattggaccacacttaatgagccatataccattagtaaccatggttatacaatcgggatccacgcacca
ggacgatgctcttcttggtatgacccaacctgccttggtggagattcgggtactgaaccatatttggtcacacacaacct
actccttgctcatgcagctgctgtaaaattgtacagagaaaaatatcaggcatctcaggaaggagtgataggaataacag
ttgtatcacattggtttgagcccgcttcggagtcacaaaaagatataaatgcttcagttcgagctttggattttatgtat
ggatggtttatggacccattgacaagaggtgactatccgcagagcatgcgatctcttgttaaagaacgactaccaaattt
cacggaagaacaatccaagtcactaattgggtcatatgattatattggagtcaactactattctgctagatatgcaagcg
cttaccctgaggattattctatacctacgcctccaagctacctcacagatgcttatgttaatgttacaacggagcttaat
ggggtccccattggtccacaggctgcttcagactggttatatgtttaccctaaaggactttacgatcttgtactctacac
aaaaaacaagtacaatgatccaattatgtacattactgagaatggcatggacgagttcaataatcccaaaatatcccttg
agcaagcccttaatgatagcaatagaattgactactgctatcgccacctctgttacctccaagaagcaattatagagggt
gctaatgtgcagggatactttgcatggtcattgctagacaactttgaatggagcgaaggatacactgttcgatttggtat
caactatgttgattacgacaatggactgaaaagacactcaaaactctcgacgcactggttcaaaaatttcctcaagagat
cctcaattagtaaggaaaaaattcgaagatgtggaaacaataatgctagggctcgcaaatttgtgtatcgaatttga
back to top