BRP40, BRP40 (gene) Rosa hybrid cultivar

Gene Overview
Name BRP40
Gene Symbol BRP40
Type gene
Organism Rosa hybrid cultivar
Synonym putative LZ-NBS-LRR resistance protein
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP40AM075248.1-BRP40Rosa hybrid cultivargene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRP40AM075248.1-BRP40.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Broad resistance to Peronospora parasitica in ArabidopsisBRPRosa hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM075248.1-BRP40 N/A AM075248.1
mRNA parsed from NCBI nr database AM075248.1-BRP40.m1 N/A AM075248.1

Sequence(s):
>AM075248.1-BRP40527
tttgaagtgaatacgattttaaaccagatgttagaatctctaaagagggataaggcaggaatgacaaatcaagatgcatt
gcttaagtctcttgaagaagagctacaagggaagagatatgttcttatcctagatgatgtttggaatgaagatagtataa
aaggggaaagtttgaggagttgtttgtcaaagctcaattctgctccgggaagcaacatcatcatcactacccgcagtgcc
aaggtggcatcaatttcggaaacacttactcggtgtgagtkggtcaaactatcaaatgatgaatgttggtccatcttgaa
gcaaagagcattgttttcagatggcaatgatccaaaccgagagagaattggaaaggaaattgctaagaagtgtggaggcg
tcccgttggtggcaaaggttttaggaggcatgatgcgtactaaaaatagtacgaaagaatggttgtcaattcaagcaagt
cgaatatgggaattacccgaagggtggaaagaatcatgtctgtttta
back to top
>AM075248.1-BRP40.m1527
tttgaagtgaatacgattttaaaccagatgttagaatctctaaagagggataaggcaggaatgacaaatcaagatgcatt
gcttaagtctcttgaagaagagctacaagggaagagatatgttcttatcctagatgatgtttggaatgaagatagtataa
aaggggaaagtttgaggagttgtttgtcaaagctcaattctgctccgggaagcaacatcatcatcactacccgcagtgcc
aaggtggcatcaatttcggaaacacttactcggtgtgagtkggtcaaactatcaaatgatgaatgttggtccatcttgaa
gcaaagagcattgttttcagatggcaatgatccaaaccgagagagaattggaaaggaaattgctaagaagtgtggaggcg
tcccgttggtggcaaaggttttaggaggcatgatgcgtactaaaaatagtacgaaagaatggttgtcaattcaagcaagt
cgaatatgggaattacccgaagggtggaaagaatcatgtctgtttta
back to top