BRP, BRP (gene) Rosa hybrid cultivar

Gene Overview
Name BRP
Gene Symbol BRP
Type gene
Organism Rosa hybrid cultivar
Synonym putative NBS-LRR resistance protein
Description black spot resistance
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRPAM411501.1-BRPRosa hybrid cultivargene
BRPAM411500.1-BRPRosa hybrid cultivargene
BRPAM411499.1-BRPRosa hybrid cultivargene
BRPAM411498.1-BRPRosa hybrid cultivargene
BRPAM411497.1-BRPRosa hybrid cultivargene
BRPAM411496.1-BRPRosa hybrid cultivargene
BRPAM411494.1-BRPRosa hybrid cultivargene
BRPAM411489.1-BRPRosa hybrid cultivargene
BRPAM411488.1-BRPRosa hybrid cultivargene
BRPAM411487.1-BRPRosa hybrid cultivargene
BRPAM411486.1-BRPRosa hybrid cultivargene
BRPAM411485.1-BRPRosa hybrid cultivargene
BRPAM411484.1-BRPRosa hybrid cultivargene
BRPAM411483.1-BRPRosa hybrid cultivargene
BRPAM411481.1-BRPRosa hybrid cultivargene
BRPAM411480.1-BRPRosa hybrid cultivargene
BRPAM411479.1-BRPRosa hybrid cultivargene
BRPAM411478.1-BRPRosa hybrid cultivargene
BRPAM411477.1-BRPRosa hybrid cultivargene
BRPAM411476.1-BRPRosa hybrid cultivargene
BRPAM411475.1-BRPRosa hybrid cultivargene
BRPAM411474.1-BRPRosa hybrid cultivargene
BRPAM411472.1-BRPRosa hybrid cultivargene
BRPAM411471.1-BRPRosa hybrid cultivargene
BRPAM411470.1-BRPRosa hybrid cultivargene
BRPAM411469.1-BRPRosa hybrid cultivargene
BRPAM411468.1-BRPRosa hybrid cultivargene
BRPAM411466.1-BRPRosa hybrid cultivargene
BRPAM411462.1-BRPRosa hybrid cultivargene
BRPAM411461.1-BRPRosa hybrid cultivargene
BRPAM411460.1-BRPRosa hybrid cultivargene
BRPAM411455.1-BRPRosa hybrid cultivargene
BRPAM411453.1-BRPRosa hybrid cultivargene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BRPAM411501.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411500.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411499.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411498.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411497.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411496.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411494.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411493.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411492.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411491.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411490.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411489.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411488.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411487.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411486.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411485.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411484.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411483.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411482.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411481.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411480.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411479.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411478.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411477.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411476.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411475.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411474.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411473.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411472.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411471.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411470.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411469.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411468.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411467.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411466.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411465.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411464.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411463.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411462.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411461.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411460.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411459.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411458.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411457.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411456.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411455.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411454.1-BRP.m1Rosa hybrid cultivarmRNA
BRPAM411453.1-BRP.m1Rosa hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Broad resistance to Peronospora parasitica in ArabidopsisBRPRosa hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database AM411501.1-BRP N/A AM411501.1
gene parsed from NCBI nr database AM411500.1-BRP N/A AM411500.1
gene parsed from NCBI nr database AM411499.1-BRP N/A AM411499.1
gene parsed from NCBI nr database AM411498.1-BRP N/A AM411498.1
gene parsed from NCBI nr database AM411497.1-BRP N/A AM411497.1
gene parsed from NCBI nr database AM411496.1-BRP N/A AM411496.1
gene parsed from NCBI nr database AM411494.1-BRP N/A AM411494.1
gene parsed from NCBI nr database AM411489.1-BRP N/A AM411489.1
gene parsed from NCBI nr database AM411488.1-BRP N/A AM411488.1
gene parsed from NCBI nr database AM411487.1-BRP N/A AM411487.1
gene parsed from NCBI nr database AM411486.1-BRP N/A AM411486.1
gene parsed from NCBI nr database AM411485.1-BRP N/A AM411485.1
gene parsed from NCBI nr database AM411484.1-BRP N/A AM411484.1
gene parsed from NCBI nr database AM411483.1-BRP N/A AM411483.1
gene parsed from NCBI nr database AM411481.1-BRP N/A AM411481.1
gene parsed from NCBI nr database AM411480.1-BRP N/A AM411480.1
gene parsed from NCBI nr database AM411479.1-BRP N/A AM411479.1
gene parsed from NCBI nr database AM411478.1-BRP N/A AM411478.1
gene parsed from NCBI nr database AM411477.1-BRP N/A AM411477.1
gene parsed from NCBI nr database AM411476.1-BRP N/A AM411476.1
gene parsed from NCBI nr database AM411475.1-BRP N/A AM411475.1
gene parsed from NCBI nr database AM411474.1-BRP N/A AM411474.1
gene parsed from NCBI nr database AM411472.1-BRP N/A AM411472.1
gene parsed from NCBI nr database AM411471.1-BRP N/A AM411471.1
gene parsed from NCBI nr database AM411470.1-BRP N/A AM411470.1
gene parsed from NCBI nr database AM411469.1-BRP N/A AM411469.1
gene parsed from NCBI nr database AM411468.1-BRP N/A AM411468.1
gene parsed from NCBI nr database AM411466.1-BRP N/A AM411466.1
gene parsed from NCBI nr database AM411462.1-BRP N/A AM411462.1
gene parsed from NCBI nr database AM411461.1-BRP N/A AM411461.1
gene parsed from NCBI nr database AM411460.1-BRP N/A AM411460.1
gene parsed from NCBI nr database AM411455.1-BRP N/A AM411455.1
gene parsed from NCBI nr database AM411453.1-BRP N/A AM411453.1
mRNA parsed from NCBI nr database AM411501.1-BRP.m1 N/A AM411501.1
mRNA parsed from NCBI nr database AM411500.1-BRP.m1 N/A AM411500.1
mRNA parsed from NCBI nr database AM411499.1-BRP.m1 N/A AM411499.1
mRNA parsed from NCBI nr database AM411498.1-BRP.m1 N/A AM411498.1
mRNA parsed from NCBI nr database AM411497.1-BRP.m1 N/A AM411497.1
mRNA parsed from NCBI nr database AM411496.1-BRP.m1 N/A AM411496.1
mRNA parsed from NCBI nr database AM411494.1-BRP.m1 N/A AM411494.1
mRNA parsed from NCBI nr database AM411493.1-BRP.m1 N/A AM411493.1
mRNA parsed from NCBI nr database AM411492.1-BRP.m1 N/A AM411492.1
mRNA parsed from NCBI nr database AM411491.1-BRP.m1 N/A AM411491.1
mRNA parsed from NCBI nr database AM411490.1-BRP.m1 N/A AM411490.1
mRNA parsed from NCBI nr database AM411489.1-BRP.m1 N/A AM411489.1
mRNA parsed from NCBI nr database AM411488.1-BRP.m1 N/A AM411488.1
mRNA parsed from NCBI nr database AM411487.1-BRP.m1 N/A AM411487.1
mRNA parsed from NCBI nr database AM411486.1-BRP.m1 N/A AM411486.1
mRNA parsed from NCBI nr database AM411485.1-BRP.m1 N/A AM411485.1
mRNA parsed from NCBI nr database AM411484.1-BRP.m1 N/A AM411484.1
mRNA parsed from NCBI nr database AM411483.1-BRP.m1 N/A AM411483.1
mRNA parsed from NCBI nr database AM411482.1-BRP.m1 N/A AM411482.1
mRNA parsed from NCBI nr database AM411481.1-BRP.m1 N/A AM411481.1
mRNA parsed from NCBI nr database AM411480.1-BRP.m1 N/A AM411480.1
mRNA parsed from NCBI nr database AM411479.1-BRP.m1 N/A AM411479.1
mRNA parsed from NCBI nr database AM411478.1-BRP.m1 N/A AM411478.1
mRNA parsed from NCBI nr database AM411477.1-BRP.m1 N/A AM411477.1
mRNA parsed from NCBI nr database AM411476.1-BRP.m1 N/A AM411476.1
mRNA parsed from NCBI nr database AM411475.1-BRP.m1 N/A AM411475.1
mRNA parsed from NCBI nr database AM411474.1-BRP.m1 N/A AM411474.1
mRNA parsed from NCBI nr database AM411473.1-BRP.m1 N/A AM411473.1
mRNA parsed from NCBI nr database AM411472.1-BRP.m1 N/A AM411472.1
mRNA parsed from NCBI nr database AM411471.1-BRP.m1 N/A AM411471.1
mRNA parsed from NCBI nr database AM411470.1-BRP.m1 N/A AM411470.1
mRNA parsed from NCBI nr database AM411469.1-BRP.m1 N/A AM411469.1
mRNA parsed from NCBI nr database AM411468.1-BRP.m1 N/A AM411468.1
mRNA parsed from NCBI nr database AM411467.1-BRP.m1 N/A AM411467.1
mRNA parsed from NCBI nr database AM411466.1-BRP.m1 N/A AM411466.1
mRNA parsed from NCBI nr database AM411465.1-BRP.m1 N/A AM411465.1
mRNA parsed from NCBI nr database AM411464.1-BRP.m1 N/A AM411464.1
mRNA parsed from NCBI nr database AM411463.1-BRP.m1 N/A AM411463.1
mRNA parsed from NCBI nr database AM411462.1-BRP.m1 N/A AM411462.1
mRNA parsed from NCBI nr database AM411461.1-BRP.m1 N/A AM411461.1
mRNA parsed from NCBI nr database AM411460.1-BRP.m1 N/A AM411460.1
mRNA parsed from NCBI nr database AM411459.1-BRP.m1 N/A AM411459.1
mRNA parsed from NCBI nr database AM411458.1-BRP.m1 N/A AM411458.1
mRNA parsed from NCBI nr database AM411457.1-BRP.m1 N/A AM411457.1
mRNA parsed from NCBI nr database AM411456.1-BRP.m1 N/A AM411456.1
mRNA parsed from NCBI nr database AM411455.1-BRP.m1 N/A AM411455.1
mRNA parsed from NCBI nr database AM411454.1-BRP.m1 N/A AM411454.1
mRNA parsed from NCBI nr database AM411453.1-BRP.m1 N/A AM411453.1

Sequence(s):
>AM411501.1-BRP543
tttgatgtttgcatctttcttgatgatgtcagaaaggctcacgcagaccatggtctagtttatctacaaaaacaaattct
ttcccaactcttgaaggaagaaaatgttcaagtatggaatgtttatagtggaatcgcttggataaagagatgtgtttgta
ataaagcggttcttctagctcttgacaatgtggaacaatcagagcaactggaaaagttggtgggagaaaaagactggttt
ggtttaaggagtagaatcatcattacaactagaaaccagcttgtattagtcactcatggtgtagaaaaaccatatgagtt
gaagggattaaacaatgatgaagctcttcaactctttagttggaaagcctttagaaaacatgagcctgaagaagattatg
cagaacagtctaagagttttgttaagtatgctggaggtcttcccttagctcttaaaactttggggcctttcttgaacgga
agaagtccagatgaatggaattctgcattggcaaaactacaccaaactcccaacataacagtt
back to top
>AM411500.1-BRP558
atcaatttgaagtttgcatctttcttgctaatgtcagagaggtttccaaacacaacccatggtctagttgatctacaaaa
acaaattctttcccaaatcttgaaggaagaaaatgttcaagtatggaatgtttatagtggaatcgcttggataaagagat
gtgtttgtaataaagcggttcttctagttcttgacaatgtggatcaatcagagcaactggaaaagttggtgggagaaaaa
gactggtttggtttaaggagtagaatcatcattacaactagaaaccagcttgtattagtcactcatggtgtagaaaaacc
atatgagttgaagggattaaacaatgatgaagctcttcaactctttagttggaaagcctttaggaaatatgagcctgaag
tagattacgtaaaacactctatgagttttgctaggtatgctggaggtcatcccttagctcttaaaactttggggtctctc
ttgtacaataaaagaagtctacattcatggagttctgcattggcaaaactacagaatactccagacaaaacagttttt
back to top
>AM411499.1-BRP634
cttgccagactagtttacgagaatatctctcatcaatttgaagtttgtatctttcttgctaatgtcagagaggtttccgc
aacccatggtctagttcatttacaaaaacagattctttcccaaatcttgaaggaagaaaatgttcaagtatgggatgttc
acagtggaatcactatgataaagagatgtgtttgtaataaagaggttcttctagttcttgacgatgtggatcattcagag
caactgaaaaacttggtgggagaaaaagactactttggtttgaggagtagaatcatcattacaactagaaaccgccatgt
actagtcgaacatgatatagaaaaacaatatgagttgaagggattagaagaagatgaagctcttcagctctttagttgga
aagcctttaggaaaattgagcctgaagaagattatgcagaacagtctaagagttttgttaggtatgctgaaggtcttccc
ttagctcttaaaattttggggtctttcttgtacaaaagaagtttagattcatggagttctgcatttcaaaaactaaaaca
aactcccaacccaacagtttttgaaatactgaaaataagttttgatggacttgatgagatggagaagaaaactt
back to top
>AM411498.1-BRP648
acactggctaaagatgtattcaacgacagtgcaactgaacaattttgcccaaagggatgggtgtgtgtgtccgatgactt
cgaccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcag
ttcaggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactac
aaacaatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcaagatcattgttactacgcgggatgcgaa
tgttgcaaaaatgatgggagacactagccctcgtaacctggagtcgatgtcagaagatgattgttggaaaatctttgtgc
accatgcactcttaaacaacagaccccaagatgctgagttattgaaggagaaaattgtagtaaaatgcaacggattgccg
ttggctgcaaggacacttgggggtcttttacgttgtaaaagagtagacgaatgggaagaaatattagaccacaagatgtg
gaatctatccgaccagatgggcatccttccagcattacaattgagctatcactatctcccttcgaatttgaaagcggtgc
ttcaccta
back to top
>AM411497.1-BRP643
cttgctaaacatgtattcaacgatgctgtaacagaacagttttacccaaagggatgggtgtctgtgtccgatgacttcga
ccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcagttc
aggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactacgat
caatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcaagatcattgttactacgcgggatgcgaatgt
tgcaaaaatgatgggagacactagccctcgtaacttggagtcgatgtcagaagatgattgttggaaaatctttgtgcacc
atgcactcttaaacaacagaccccaagatgttgagttattgaaggagaaaattgtagtaaaatgcaacggattgccgttg
gctgcaaggacacttgggggtcttttacgttgtaaaagagtagacgaatgggaagagatattagaccacaagatgtggaa
tctatccgaccagatgggcatccttccagcattacaattgagctatcactatctcccttcgaatttgaaacggtgcttca
cct
back to top
>AM411496.1-BRP642
cttgctaaacatgtattcaacgatgctgtaacagaacagttttacccaaagggatgggtgtctgtgtccgatgacttcga
ccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcagttc
aggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactatgat
caatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcatcatccttgtgacgacacgtgatgcgaatgt
tgcgaagatgatgggagacactaaacctcataacttggagtcgatgttagaagttgattgttgggaagtctttgtgcacc
atgcactcttaaacaacataccccaagatgttgtgttacttaaagagaaaattgtagtaaaatgcaatggattgccgttg
gctgcaaggactcttggtggtcttttacgttgcaaaagagtagacgaatgggaagaagtattagaccacaagttgtggaa
tctatctgaccagatgggcattcttccagcattacaattgagctatcattatctcccttcaaagttgaaacgctgcttca
cc
back to top
>AM411494.1-BRP679
cttgcccaactagcctataatgatgaaaatgttactgcccattttgataagaaagtatgggtttgtgtctcggacccttt
tgacgagattaaaattgctagagcaatcattgagagtctagataaaaatgaaacccaaagaaattcagatgagttggaaa
ccctactcttgtgcataaagactcatgttgagagtaagaagttactcctcgtgctagatgatgtgtggaccgaagacaaa
accaagtgggaaaatttgaaactatcagtaataatgcaaagttgtgaagaagggagtacagtactggttaccacgcgaaa
acaagaggttgctaaaatgatgagagcaactagtaacatgattcatttagataagttgaataagttgaatgatacagatt
gtctagcattgttcaatagcatcgcatttttcaataggaaacaagatgaggccaatgggtttggagttattggtgaggaa
attgtgaagaagtgtaaaggtttgcctcttgctgcaaagactttgggcagtctagtgtgggataagaaaacaagagatga
atggcaggatgtactaaatagtcagatatgggaattagaagaagttgagcaacaagttttccgaccattgttactaagtt
atttcgatttggctcctatagtcaaaatgtgtcttttgt
back to top
>AM411489.1-BRP671
cttgcccaactagcctataatgatgaaaatgttactgcccattttgataagaaagtatgggtttgtgtctcggacccttt
tgacgagattaaaattgctagagcaatcattgagagtctagataaaaatgaaatccaaagaaattcagatgagttggaaa
ccctactcttgtgtataaagactcatgttgagagtaagaagttactcctcgtcctagatgatgtgtggaccgaagacaaa
accaagtgggaaaatttgaaactatcagtaataatgcaaagttgtgaagaagggagtacaatactggttaccacgcgaaa
acaagaggttgctaaaatgatgagagcaactagtgacatgatccatttagataagttgaatgatacggattgtctagcat
tgttcaatagcatcgcatttttcaataggaaacaagatgaggccaatgggtttggagttattggtgaggaaattgtgaaa
tggtgtaaaggtttgcctcttgctgtaaagactttgggcagtctactgtggtataagaaaacaagaaaggaatggcggga
tgtactaaatagtcagatatgggaattagaagaagttgagcaacaagttttccgaccattgttactaagttatttcgatt
tggctcctgtagtcaaaaggtgtctcttgta
back to top
>AM411488.1-BRP665
ctcacccagttagtctataaccatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatctttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaaacagttccaatgagttggaaattttat
tgggatgtatcgagacacatgttaagaataagaagttactcattgttctagatgatgtgtggaccgaagacaaaacaaag
tgggaaaatttgaaactaccagtaataatgcagagttgtgctcagggtagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaatgatgagagcaaccagcaacatgatccatttggacaagttgagcgatagggattgtctagcattgttca
atagctttgcatttttggatagggaagaagatgaggctaatgggtttggagctattggtgaggaaattgtgaaaaagtgt
aaaggtttgcctcttgctgcaaagactttaggcagtctagtgtggtataagaaaacaagagaggaatggcgggatgttct
gaatagtaagatatgggaactagaagaagttgaacaacaagttttccgaccactattactaagttattatgatttggctc
ctgcagtcaaaaggtgtcttttgta
back to top
>AM411487.1-BRP665
ctcgcccagttagcctataaccatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaagcagttccaatgagttggaaatcttat
tgggatgtatcgagacacgtgttragaataagaagttactccttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccgataataatgcagagttgtgctcagggtagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccagcagcatgatccatttggacgagttgagcggtagggattgtctggctttgttca
atagctttgcgtttttggatagggatgaagatgaggctgacgggttgggagctattggtgaggaaattgtgaaagggtgt
aaaggtttgcctcttgctgcaaagactttaggtagtctastgtggtataagaaaacaagagaggaatggcgggatgttct
gaagagtgagatatgggaactagaagaagttgaggaacaagttttccgaccactgttgctaagttattatgatttggccc
ctgcagtcaaaaggtgtcttttgta
back to top
>AM411486.1-BRP664
cttgcccaattagcctataacaatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaagcagttccaatgagttggaaattttat
tgggatgtatcaagacacgtgttgagaataagaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccaataataatgcaaagttgtgctaagggcagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtttggctttgttca
atagcatcgcgtttttggatagggaagaaaatgaggctggtgagttgggagatattggtaagaaaattctgaaacggtgt
aaaggtctgcctcttgctgtaaagactttaggtagtctattgtggtataagaaaacaagaaaggaatgggaggatgttct
gaagagtgagatatgggaattagaaaaagttgagcaaaatgttttccgaccactattattaagttattatgatttggccc
ctgctgtcaaaatgtgtcttttgt
back to top
>AM411485.1-BRP643
cttgccaagttggtctacaatgatgaaatggtcgttgggcatttcgatttgcggatgtgggtgtatgtgtcagtggactt
tgatattcataggctgatggaaaagatccttagttctgcactaggtaaagaaatcagtgagaaaatgtctgtggatcaat
tacaagcaaagttacgtgagtcattgaaggataagaaatatttgcttgtcttggatgatgtatggaatgaggatcgtagt
caatggagtgacttgagaaatttgttgatagacgggatcaaattaggaagtaaaatcttagtgacaacccgtaatctctc
agttgcttcaatcatgggcactgaacaaccatacaatttagctggcctttcttatgagtattgtttgtcattgtttacaa
aatgtgcattcaaggaaggtgatgagaaacagcatccacacctctttgaaattggaaaagagattgtgaagaagtgcgga
ggggctccgttggcggtgagaactttagggagtcaactgtactcagagactgatgagcgtcgatggaaattagtaagaga
ttctaagatatgggaattggagagagggagtggtcatatcttgcctgctttgagattgagttatattcaattgccttcat
acc
back to top
>AM411484.1-BRP664
ctcacccaactagtctttaacaatgaaaaggttgcagcccattttgacaagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcactgaaaatctagatggatcccaaagcagttccaatgagttggaaattttat
tgggatgtatcaagacacgtgttgagaataagaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccaataataatgcaaagttgtgctaagggcagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtttggctttgttca
atagcattgcgtttttggatagggatgaagatgaggctgatgagttgggagatattggtaagaaaattgtgaaacggtgt
aaaggtttgcctcttgctgcaaagactttaggtagtctactgtggtataagaaaacaagaaaggaatgggaggatgttct
gaagagtgagatatgggaattagaaaaagttgagcaacatgttttccgaccactgttgcttagttattatgatttggccc
ctgcagtcaaaaggtgtcttctat
back to top
>AM411483.1-BRP642
acgacacttgctcgagctatccatgatcaaatttgtcagcattttgaccaaagctgctttctttccaatgttagagaaat
ttctaaaaacaatggcctagtttctctacaagaaaaacttctttccaggatcctgatagcaaaagttaaaaatatagagg
atgaatacacaggagctgctatgataaaaaggcggttgtgtaggaaaaaggtgcttgttgttattgatgatgtggatcag
ttgacacaattagagaaattggctggaaatcgcaactggtttggtccagggactagaattatcataaccaccacagattt
tcagttgttaaaggcacatgctgttgatgctacgtacaaggctaacggcttaaactgtgatgaagcacttcaacttttga
gtttgaaggcttttaagaaatgtcccccaccaaaagattatttgcatctgtgctacgatgttatagggtatgctaagggg
cttccgttggctctcgtggtcttaggttcttttctatttggtagaagcgctgatgaatgggcaagtgcaatagataggct
aaagaacacaccagataaacgcattattgaggtgcttcggattagttttgatggacttgatgaaaaagacaaagaaatat
tc
back to top
>AM411481.1-BRP632
atggtaagagcggtgtatgcgagaatctctcgtgaattcgaatttagtttcattcttactgatgttagaaagtccgttga
agaaaggggtctacttaagttacaaaagcaacttctctctgcgatttggacaaagaaggccagcttatcagaccctcatg
aaggagccgactttataaggaggttgttaggtcacaaaaaagttcttcttgttcttgatgatgtgaaccatccaagccat
ttaaaatatttggcaggaaaccaagactggtttggttcagggagtagagtgcttatcacaactagaaatgagcatttgtt
gattcaacatggagtgaagacaagattgaaggtcgaagaattaaaccatgatgattctcttaagctttttagctggaaag
cattccaaagaggttaccctgaagaagattttcatggtttgtcagagtctgttataaattatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttacgtggaagggatctaagtgaatggaacagtgcactgagaaaactgggaagagt
ttgtaacttggaaatctttgacatacttaaaataagttacaatgatctagattctgaagagaagaaaatatt
back to top
>AM411480.1-BRP632
atggtaagagcggtgtatgcgagaatctctcgtgaattcgaatttagtttcattctaactgatgttagaaagtccgttga
agaaagtggtctacttaagttacaaaagcaacttctctctgggatttggacaaagaaggccaagttatcagaccctcatg
aaggagccacctttataaggaggttgttaggtcacaaaaaagttcttcttgttcttgatgatgtgaaccatccaagccat
ttaaaatatttggcaggaaacaaagactggtttggttcagggagtagagtgcttatcacaactagaaatgagcatttgtt
gattcaacatggcgtggggagaagattgaaggtcgaagaattaaatgatgatgattctcttaagctttttagctggaatg
cattcgaaagaggtgaccctgaagaagattttcttggtttgtcagaatcttttgtaagttatgccaaaggtcttcctcta
gctcttgaagtactgggttcttttttgcatggaagggatctaattgaatggaacagtgcactgagaaaactgggaagagt
ttgtaacttggaaatctttgacatacttaaaataagttacgacggtcttgattctgaagacaagacaatatt
back to top
>AM411479.1-BRP465
atggtaagagcggtgtatgagagaatctctcgtgaatttcaattcagtttccttattaccgatgttagaaactccgttga
aaatggtggtttacttaatctgcaaaagcaacttctctctgggattggggcaaaaaaggctgacatattagacctgcatg
aaggagccaccatattacagaggttattacgtcacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttaaaatatttggcaggaaaccaagagtggtttcgttcagggagtagagttcttatcacaactagaaatgagcatttgtt
ggttcaacatggagtggagagaagattgaaggtcgaagaattaaaccatgatgattctcttacgctttttagctggaaag
cattccaaagaggttaccctgaagaaggttttcatggtttgtcagagtctgttataaattatgcc
back to top
>AM411478.1-BRP632
atggtaagagcggtgtatgagagaatctcttgtcaatttgaatttagtttccttcttaccgatgttagagactctgttga
aaaaagtggtctacttaatctacaaaagcaacttctctctgggatttggacaaaaaaggcagacgtatcagaccttcatg
aaggagccaccataataaggaggttgttgggtcacaaaaaagttcttctcattcttgatgatgtgacccatttaagccat
ttgaaatatttggcaggaaaccaagattggtttggttcagggagtagagttctcatcacaactagaaatgagcatttatt
gatcgaacatggagtggagagaagattgaaggttgagggatttgatgatgaggattctcttcagcttttcagctggaaag
cattcaaaagaggttaccctgaagaagattttcttgctttgtcaaaatctgttataaactatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttgtatggtagagatctaagtgaatggaagagtgcattgaaaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgaagagaagaatatttt
back to top
>AM411477.1-BRP635
actatggtaagagcggtgtatgagagaatctctcgtgaatttgaatttagtttccttcttaccgatattagagactccgt
tgaaaaaagtggtttacttaatctacaaaagcaacttctctctgggatttggacaaaaagggccgacattttagaccttc
atgaaggagccaccataataaggaggttgttaggtcacaagaaagttcttctcattcttgatgatgtgatccgttcaagc
catttgaaatatttggcaggaaaccaagattggtttggttcagggagtagagttctcattacaactagaaatgagcattt
attgatcgaacatggagtcgagagaagattgaaggttgaggaatttaatgatgaggattctcttcagcttttcagctgga
aagcattcaaaagaggttaccctgatgaagattttcttgatctgtctaaatctgtcataaattatgccaaaggtctccct
ttagctcttgaagtactgggctcttttttgcatggaagagatctaagtgaatggaacagtgcattgagaaaactaggaag
agtttgtaacttggaaatttttgacatacttaaaacaagttatgatggtctagatgatgaagagaagaaagtatt
back to top
>AM411476.1-BRP630
atggtaagagcggtgtatgagagaatctctcgtgaatttgaatttagtttccttcttactgatgttagaaactttgttga
aaaaagtggtctacttaatttacaaaagcaacttctgtctgggatttggacaaagaagtccaacatatcagaccttcatg
aaggagccatgattataaggaggttgtttggtgacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttagaatatttggcaggaaacccagagtggtttggttcagggagtagagttcttatcacaactagaaatgagcatttgtt
gattggacatggagtggagagaagattgaaggtcgaagaattaaatgatgctgattctcttcaggtttttagccggaaag
cattcaaaagagtttaccctgaaggagattttcttggtttgtcagaatatgttataagttatgcaaaaggtgttccttta
gctcttgaagtactgggttcttttttgcatggaagagatcttagtgaatggagaagtgcactgagaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaacgatctggattctgaagagaagaaaata
back to top
>AM411475.1-BRP633
atggtaagagcggtgtatgagagaatctctcatgaatttgaatttagtttccttctttccgatgttggaaactccgttga
aaaaggtggtctacttaatctacaaaagcaacttatctctagtatttggacaaaaaaggctgacatatcagaccttcatg
aaggagccaccatactaaggaggttgttaggtcacaaaaaagttcttctcattcttgatgatgtgaaccattcatgccat
ttaaaatatttggcaggaaaccaagagtggtttggttcggggagtagagttcttatgacaactagaaatgagcatttgtt
gattgaacatggagtggagagaagattgaaggctgaagaattaaatgatcaggattctcttcagctttttagctggaaag
cattcaaaagaggataccctgaagaagattttcttggtttgtcagaatctgttataagttatgccagaggtcttccttta
tctcttgaagtactgggctcttttttgtatggaagagatctaagtgaatggaatagtgcattaagaaaactacgaagagt
ttttaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgcaagagaagaaaatatt
back to top
>AM411474.1-BRP632
atggtaagagcggtgtatgagagaatctctcatgaatttgaatttagtttccttcttaccgatgttagagactccgttga
aaaaagtggtttacttattctacaaaagcaacttctctctgggatttggacaaaaaaggctgacatttcagacctttatg
aaggagccaccaaaataaagaggttgttaggtcacaagaaagttcttctcattcttgatgatgtgacccattcaaggcat
ttgaaatatttggcaggaaaccaagagtggtttggtttagggagtagagttcttatcacaacaagaaatgagcatgtatt
gattgaacatggtgtggagagaagattgaaggtcgaagaattaaatgatgacgattctcttcagcttttcagctggaaag
cattcaaaagaggttaccctgaagaagattttcttgctttgtcaaaatctgttataaactatgccaaaggtctgccttca
gctcttgaagtactgggttcttttttgtatggaagagatctaagtgaatggaagagtgcattgaaaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgaagagaagaatatttt
back to top
>AM411472.1-BRP632
atggtaagagcggtgtatgagagaatctcttgtgaatttcaattcagtttccttattactgatgttagaaactccgttga
aaatggtggtttacttaatctgcaaaagcaacttctctctgggattggggcaaaaaaggctgacatattagaccttcatg
aaggagccaccatattacagaggttattacgtcacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttaaaatatttggcaggaaaccaagagtggtttggttcagggagtagagttcttatcacaactagaaatgagcatttgtt
gattcaacatggagtggagagaagattgaaggtcgaagaattaaaccatgatgattctcttaagctttttagctggaaag
cattccaaagaggctaccctgaagaggattttcatggtttgtctgagtctgttataaattatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttgtatggaagagatccaagtgtatggaacagtgcactgacaaaactgggaagagt
ttgtaacttggaaatttttgacacacttaaaataagttacaatgatctagattccgaagagaagaaaatttt
back to top
>AM411471.1-BRP470
attgcccaagtggtttatgaaagggtacaagctcagttcgaaggttgcagctttcttgataatgtgagagagcagataac
tgaaaaacaaggtgcagttcatttacagcagcaacttctttcggatttgctgaaatgtagtgtaaatgtacagaacacta
aaacaggaaaaaagataatgaggcagagactaagtactaaaatggttcttatcattcttgatgatgtggacaaagaaaaa
caattggaagcattgtgtgatagggaatcggttggtccaggcagtagaatcatcataacttgtagagatgaacatttgct
cagtgtagttgaaggagacaaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaag
ccctcaagaaagaccagctggttggaaaagaaattctgaagctatccaaagaattgttgaaatatgctaa
back to top
>AM411470.1-BRP635
attgcacaagtggtttttgaaaggctaagagctcagtttgaaggtgatagctttcttgagaatgttaaacaggaaactga
aatgaagcaaggtagtacaattcatttacaagagaaacttctcttgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaatgggaaaagacataattaagcatagactatctactaaaagagtgcttgttgttcttgatgatgtggatcaagat
aaacaattggaaacattgtgtggtcgtacttggtttggtccagggagtagaatcatcataacttccagagatgaacacct
gattagtgcatttggagcagataaagtatacaaggtgaatgcattaactgatcctgaagcttttgagctctttcatttga
aagccttcaatgaagacgaggttggagaagattttctcaagctatccaaggaatttttgaaatatgctaattgccttcca
ttagctattaaaattttgggatcgtctgtttgtggtagaagtgtaaagttatggtcaagtgaattgaagagacttgaaaa
aaatcctccgaaaaagatttttgatgttcttaaatttagttttgatggattacaagaaacagaaaagaaaacgtt
back to top
>AM411469.1-BRP634
attgcacaagtggtttttgaaaggctaagagctcagtttgaaggtgatagctttcttgagaatgttaaacaggaaactga
aatgaagcaaggtagtacaattcatttacaagagaaacttctcttgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaatgggaaaagacataattaagcatagactatctactaaaagggtgcttattgttcttgatgatgtggatcaagat
aaacaattggaaacactgtgtgatcgtacttggtttggtccagggagtagaatcatcataacatccagagatgaacactt
gatcagtgcatttggagcagacgaagtatacagggtgaatgcattaactgagcctgaagctttggagctctttagtttga
aagccttcaaggaagacgaggttggagaagattttctcaagctatccaaggaatttttgaaatatgctaatggccttcca
ttagctattgaagttttaggatcgtccgttcgtggtagaagtgcaaagatatggttaagtgcattgaatagacttaaaaa
aaaccctgaaaaagggattattaatgttcttaaagtcagttttgatggattagaagaaacagaaaagaaaacgt
back to top
>AM411468.1-BRP635
ttgcacaagtggctttttgaaagggtaaaagctcagtttgcaggtgatagctttcttgagaatgttaaagaagaaactga
aaagaagcaaggtagtacaattcatttacaagagaaacttctattgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaacgggaaaagacataattaagcatagactatctgctaaaagagtgcttgttgttcttgatgatgtggatcaagat
aaacaattggaaacattgtgtgatcgtacttggtttggtccagggagtagaatcatcataacatccagagatgaacactt
gatcagtgcatttggagcagataaagtatacaaggtgaatgcattaactgatcctgaagcttttgagctctttagtttga
aagcctttaaggaagacaaggttggagaagattttctcaagctatcaaaggaatttttgaaatatgccaatggccttcca
ttagctattgaagttttgggatcgtctgttcgtggtagaagtgtaaagttatggtcaagtgcattgaagagacttaaaaa
gaatcctcaaaaagggattattgatgttcttaaagttagttttgatgaattagaagaaagagaaaagaaaacgtt
back to top
>AM411466.1-BRP467
attgcacaagtggtttttgaaagggtacaagctcagtttgatggttgcagctttcttgagaatgttagagaggtaattga
aaagcaaggtgcagtgcatttacaagagcaactgctttcgaatttgctgagatttagtgtaaatgtacagaacactaaaa
tgggaaaaaatataatgaggcagaggctatgtactaaaatggttcttctcattcttgatgatgtggaccaagaagaacaa
ttggaagcattgtgtgatagggaatcgtttggtccagggagtaggatcatcataacttctagagatgaacatttgctcag
tgcagttgaaggaggtaaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaagcct
ttaagaaagaccagctggttggagaagaaattctgaagctatccaaagagtttttgaaatatgctaa
back to top
>AM411462.1-BRP640
attgcaaaagctgtttacaacttaattgctcgtaagtttgaaggttgttgtttcttggcaaatgttagtgcagcttcagt
accctatcaaggcctagttcaactacaaaatgagcttctttatgagattttaggggggcggaaaatggagatgactaatg
ctgatagaggaatccaggtgataaaggaaagattgggtagtaaaagggttctcttagttctagatgatgtgaatgaattg
aaccagttggacaaattagctggaggattggattggtttggttgtggcagcagaattatcataacaacgagagataaacg
tttgctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctcttgattt
tgaatgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctttactctatactcactgc
cttccattagctgtgaacattttaggttcatttctctgtggtatgagtataaatcaatggcatactgcattggatggtta
cagaagatttcctaacggcgatatccaaaaagtccttgaaacaagttacgatgcattggaatatccattgaaagaagcat
back to top
>AM411461.1-BRP647
acgacaattgctaaagctgtttacaactcaattgccagtaagtttgaaggttgttgtttcttgggaaatgttagagcaaa
ttcaataccccatggaggcctagttcggctacaaaataatcttctttatgagattttaggggaccggaaagtgaagatga
ccgatgctgataggggaatccaggtgataaaggaaaggttaggtagtaaaagggttctcttagtcattgatgatgtgaag
gaattgaaccagttggacaaattagctggaggattggattggtttggtcgtggcagcagaattatcataacaacaagaga
taaacatttgctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctct
tgattttgaatgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctttactctatact
cactgccttccattagctgtgaacattttaggttcacatctctgtggtaagagtataaatcaatggcatgctgcattaga
taattacagaaagtttcctaattgcgatatccaaaaagttctcaaaacaagttacagtgcattggaagatcctttgaaag
aagcatt
back to top
>AM411460.1-BRP636
gctaaagctgtttacaactcaattgccagtaagtttgaaggttgttgtttcttgggaaatgttagagcaaattcaatacc
ccatggaggcctagttcggctacaaaataatcttctttatgagattttaggggaccggaaagtgaagatgaccgatgctg
ataggggaatccaggtgataaaggaaaggttaggtagtaaaagggttctcttagtcattgatgatgtgaaggaattgaac
cagttggacaaattagctggaggattggattggtttggtcgtggcagcagaattatcataacaacaagagataaacattt
gctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctcttgattttga
atgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctctactgtatgctcacggcctt
ccattagctgtaaacattttaggttcacttctctgtggtaagggtataaatcaatggcatgctgcattagatggttacag
aagatttcctaacagcgatatccaaaaagtccttcaaacaagttacaatgcattggaagatccgttgaaagaagca
back to top
>AM411455.1-BRP635
attgcaaaattagtttacaattcaaattttgaaaagtttgatggaagcagctttcttgagaatataagacaattttcgga
gctacctaatggcttagttttaatacaaacaaaacttctttgtgatattgggaaaaaggtggaaatacacagcgttagtg
agggaatacctaggattgaaaaggtcttgcgctctaaaagagttcttcttgttcttgatgatgtggatcatacggaccaa
ctagatgcagtgcttatgatgcaagataagtttcatccaggaagtagaatcatcataacaactaggcatgcgaggttgtt
gaatgttgatagagctattgaggtctataaccttgaaactttggatttcgatgactcactgaagctcttcagttggcatg
ctttcggacggaactatcctaataaaggttacatggaacattcaaaaaggctagtgcaccatagtggaggtcttccatta
gctctaaaagtttttggttcttccctatcgaggcaaagtatagatgtatgggaaagtgcattagagaaattggaagtaat
tccaaatggtgaaatcatgaacaaactcaaaataagctatgactctttacaagacagccatgacaaagatttatt
back to top
>AM411453.1-BRP627
attgctagagctgtttatgacgaaattgtttgtcaatttgaacactattgctttcttgaaaatgtcaaggaaggtttcaa
gcataatggtgccatacatatgcaggaagaacttctatctaggatttttgagaaaagcgtgcgcagtctaggcactttga
gtagaggttccaagatgataatggataggctgagtaagaaaaaagttctgcttgttcttgatgatgtagagaactttaac
cagattgaagagttacttggaaagcagcattcatttggtagagggagtagaatcattgtaaccactagggatatacaatc
actcagtggagttaatgagagatatagtcccatgtttctaagcgatggtgaagctcttgaactttttttgcagtatgcct
tcagaacaaaccaacctacgagagagtatgatcctctctcaaggcgtgctgtagaatatgctcaaggtctacctttagca
ctcaaagttttgggagctagtcttgatggcaaaagtatatgtgagtgggaagatgagctggagaaaataaaggaaatccc
gcataaggaaattcagggtgtgcttaggacaagctttgacggactggatccttcacagcaggaaatc
back to top
>AM411501.1-BRP.m1543
tttgatgtttgcatctttcttgatgatgtcagaaaggctcacgcagaccatggtctagtttatctacaaaaacaaattct
ttcccaactcttgaaggaagaaaatgttcaagtatggaatgtttatagtggaatcgcttggataaagagatgtgtttgta
ataaagcggttcttctagctcttgacaatgtggaacaatcagagcaactggaaaagttggtgggagaaaaagactggttt
ggtttaaggagtagaatcatcattacaactagaaaccagcttgtattagtcactcatggtgtagaaaaaccatatgagtt
gaagggattaaacaatgatgaagctcttcaactctttagttggaaagcctttagaaaacatgagcctgaagaagattatg
cagaacagtctaagagttttgttaagtatgctggaggtcttcccttagctcttaaaactttggggcctttcttgaacgga
agaagtccagatgaatggaattctgcattggcaaaactacaccaaactcccaacataacagtt
back to top
>AM411500.1-BRP.m1558
atcaatttgaagtttgcatctttcttgctaatgtcagagaggtttccaaacacaacccatggtctagttgatctacaaaa
acaaattctttcccaaatcttgaaggaagaaaatgttcaagtatggaatgtttatagtggaatcgcttggataaagagat
gtgtttgtaataaagcggttcttctagttcttgacaatgtggatcaatcagagcaactggaaaagttggtgggagaaaaa
gactggtttggtttaaggagtagaatcatcattacaactagaaaccagcttgtattagtcactcatggtgtagaaaaacc
atatgagttgaagggattaaacaatgatgaagctcttcaactctttagttggaaagcctttaggaaatatgagcctgaag
tagattacgtaaaacactctatgagttttgctaggtatgctggaggtcatcccttagctcttaaaactttggggtctctc
ttgtacaataaaagaagtctacattcatggagttctgcattggcaaaactacagaatactccagacaaaacagttttt
back to top
>AM411499.1-BRP.m1634
cttgccagactagtttacgagaatatctctcatcaatttgaagtttgtatctttcttgctaatgtcagagaggtttccgc
aacccatggtctagttcatttacaaaaacagattctttcccaaatcttgaaggaagaaaatgttcaagtatgggatgttc
acagtggaatcactatgataaagagatgtgtttgtaataaagaggttcttctagttcttgacgatgtggatcattcagag
caactgaaaaacttggtgggagaaaaagactactttggtttgaggagtagaatcatcattacaactagaaaccgccatgt
actagtcgaacatgatatagaaaaacaatatgagttgaagggattagaagaagatgaagctcttcagctctttagttgga
aagcctttaggaaaattgagcctgaagaagattatgcagaacagtctaagagttttgttaggtatgctgaaggtcttccc
ttagctcttaaaattttggggtctttcttgtacaaaagaagtttagattcatggagttctgcatttcaaaaactaaaaca
aactcccaacccaacagtttttgaaatactgaaaataagttttgatggacttgatgagatggagaagaaaactt
back to top
>AM411498.1-BRP.m1648
acactggctaaagatgtattcaacgacagtgcaactgaacaattttgcccaaagggatgggtgtgtgtgtccgatgactt
cgaccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcag
ttcaggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactac
aaacaatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcaagatcattgttactacgcgggatgcgaa
tgttgcaaaaatgatgggagacactagccctcgtaacctggagtcgatgtcagaagatgattgttggaaaatctttgtgc
accatgcactcttaaacaacagaccccaagatgctgagttattgaaggagaaaattgtagtaaaatgcaacggattgccg
ttggctgcaaggacacttgggggtcttttacgttgtaaaagagtagacgaatgggaagaaatattagaccacaagatgtg
gaatctatccgaccagatgggcatccttccagcattacaattgagctatcactatctcccttcgaatttgaaagcggtgc
ttcaccta
back to top
>AM411497.1-BRP.m1643
cttgctaaacatgtattcaacgatgctgtaacagaacagttttacccaaagggatgggtgtctgtgtccgatgacttcga
ccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcagttc
aggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactacgat
caatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcaagatcattgttactacgcgggatgcgaatgt
tgcaaaaatgatgggagacactagccctcgtaacttggagtcgatgtcagaagatgattgttggaaaatctttgtgcacc
atgcactcttaaacaacagaccccaagatgttgagttattgaaggagaaaattgtagtaaaatgcaacggattgccgttg
gctgcaaggacacttgggggtcttttacgttgtaaaagagtagacgaatgggaagagatattagaccacaagatgtggaa
tctatccgaccagatgggcatccttccagcattacaattgagctatcactatctcccttcgaatttgaaacggtgcttca
cct
back to top
>AM411496.1-BRP.m1642
cttgctaaacatgtattcaacgatgctgtaacagaacagttttacccaaagggatgggtgtctgtgtccgatgacttcga
ccttctaagggtgacaactgcagttcttgaatctgtcacgtcaggtgatgtgaaggaatccaaagagctcaattcagttc
aggagaagttgagtaaggaattggctggcaaaaagtttttaattgttctagatgatgtctggaatacatgcaactatgat
caatggacaacattgcagtccgcctttcgtgttggagcagtaggaagcatcatccttgtgacgacacgtgatgcgaatgt
tgcgaagatgatgggagacactaaacctcataacttggagtcgatgttagaagttgattgttgggaagtctttgtgcacc
atgcactcttaaacaacataccccaagatgttgtgttacttaaagagaaaattgtagtaaaatgcaatggattgccgttg
gctgcaaggactcttggtggtcttttacgttgcaaaagagtagacgaatgggaagaagtattagaccacaagttgtggaa
tctatctgaccagatgggcattcttccagcattacaattgagctatcattatctcccttcaaagttgaaacgctgcttca
cc
back to top
>AM411494.1-BRP.m1679
cttgcccaactagcctataatgatgaaaatgttactgcccattttgataagaaagtatgggtttgtgtctcggacccttt
tgacgagattaaaattgctagagcaatcattgagagtctagataaaaatgaaacccaaagaaattcagatgagttggaaa
ccctactcttgtgcataaagactcatgttgagagtaagaagttactcctcgtgctagatgatgtgtggaccgaagacaaa
accaagtgggaaaatttgaaactatcagtaataatgcaaagttgtgaagaagggagtacagtactggttaccacgcgaaa
acaagaggttgctaaaatgatgagagcaactagtaacatgattcatttagataagttgaataagttgaatgatacagatt
gtctagcattgttcaatagcatcgcatttttcaataggaaacaagatgaggccaatgggtttggagttattggtgaggaa
attgtgaagaagtgtaaaggtttgcctcttgctgcaaagactttgggcagtctagtgtgggataagaaaacaagagatga
atggcaggatgtactaaatagtcagatatgggaattagaagaagttgagcaacaagttttccgaccattgttactaagtt
atttcgatttggctcctatagtcaaaatgtgtcttttgt
back to top
>AM411493.1-BRP.m1557
tttgataagaaagtttgggtttgtgtctcggatccttttgatgagattaagattgctaaagcgatcattgaaaatctaga
tggatcgcaaagcagttccaatgagttggaaattttattgggatgtatcaagacacgtgttgagaataagaagttactca
ttgttctagatgatgtgtggaccgaagacaaaactaagtgggaaaatttgaaactacaagtgataatgcaaagttgtgct
cagggcagtataatattggtgaccacacgaaaagaagaggttgctaaaatgatgagagcaaccagcaacatgatccattt
ggacaagttgagcgatatggattgtctcgcattgttcaatagctttgcatttttggatagggaagaagatgaggctaact
cgtttggagctattggtgaggaaattgtgaaaaagtgtaaaggtttgcctcttgctgcaaagactttaggcagtctagtg
tggtataagaaaacaagagaggaatggcgggatgttctgaatagtaagatatgggaactagaagaagttgagcgaca
back to top
>AM411492.1-BRP.m1518
ctggaaactgtactgttatgtataaggacacgtgttgagaaaaagaagttcctcctagtcctagatgatgtgtggaccga
agacaaaacaaagtgggaaaatttgaaactgcaagtgataatgcaaagctgtgctcaggacagtacaatattggtgacca
cgcgaaaagaaggggttgctaaaatgatgagagcaaccagcagcatgatccatttggacaagttgagcgatagggattgt
ctagcattgttcaatagctttgcatttttggatagggaagaagatggggctaatgggtttggagttattggtgcggaaat
tgtgaaaaagtgtaaaggtttgcctcttgctgcaaagactttaggcagtctagtgtggtataagaaaacaagagaggaat
ggcaggatgttctgaatagtaagatttgggaattagaagaagttgaggaacaagttttccgaccactgttactaagttat
tatgatttggcccctgcagtcaaaagatgtcttttgta
back to top
>AM411491.1-BRP.m1665
ctcacccagttagtctataaccatgaaaatgttacggcccattttgataagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggaacccaaagcagtttgaatgagttggaaattttat
tgcagcatatcaagacacgtgttgagaataagaagttactcatggttctagatgatgtgtggacggaagaacataaaaag
tgggaaaatttgaaactacaagtgataatgcaaagttgtgctaagggcagtaaaatactggtgaccacacgaaaagaagg
ggttgctaacatgatgagagcaaccagcagcatgatccatttggacaagttgagcgatagggattgtctagcattgttca
atagctttgcatttttggatagggaagaagatgaggctaatgggtttggagctattggtgaggaaattgtgaaaaagtgt
aaaggtttgcctcttgctgcaaagactttaggtagtctagtgtggtataagaaaacaagagaggaatggcgggatgttct
gaatagtaagatatgggaactagaagaagttgaggaacaagttttccgaccactgttactaagttattatgatttggctc
ctgcagttaaaaggtgtcttttgta
back to top
>AM411490.1-BRP.m1622
tttgataagaaagtttgggtttgtgtctcggatccttttgatgagattaagattgctaaagcgatcattgaaaatctaga
tggatcgcaaagcagttccaatgagttggaaattttattgggatgtatcaagacacgtgttgagaataagaagttactca
ttgttctagatgatgtgtggaccgaagacaaaactaagtgggaaaatttgaaactacaagtgataatgcaaagttgtgct
cagggcagtataatattggtgaccacacgaaaagaagaggttgctaaaatgatgagagcaaccagcaacatgatccattt
ggacaagttgagcgatatggattgtctcgcattgttcaatagctttgcatttttggatagggaagaagatgaggctaact
cgtttggagctattggtgaggaaattgtgaaaaagtgtaaaggtttgcctcttgctgcaaagactttaggcagtctagtg
tggtataagaaaacaagagaggaatggcgggatgttctgaatagtaagatatgggaactagaagaagttgagcgacaagt
tttccgaccactattactaagttattatgatttggctcctgcagtcaaaatgtgtcttttgt
back to top
>AM411489.1-BRP.m1671
cttgcccaactagcctataatgatgaaaatgttactgcccattttgataagaaagtatgggtttgtgtctcggacccttt
tgacgagattaaaattgctagagcaatcattgagagtctagataaaaatgaaatccaaagaaattcagatgagttggaaa
ccctactcttgtgtataaagactcatgttgagagtaagaagttactcctcgtcctagatgatgtgtggaccgaagacaaa
accaagtgggaaaatttgaaactatcagtaataatgcaaagttgtgaagaagggagtacaatactggttaccacgcgaaa
acaagaggttgctaaaatgatgagagcaactagtgacatgatccatttagataagttgaatgatacggattgtctagcat
tgttcaatagcatcgcatttttcaataggaaacaagatgaggccaatgggtttggagttattggtgaggaaattgtgaaa
tggtgtaaaggtttgcctcttgctgtaaagactttgggcagtctactgtggtataagaaaacaagaaaggaatggcggga
tgtactaaatagtcagatatgggaattagaagaagttgagcaacaagttttccgaccattgttactaagttatttcgatt
tggctcctgtagtcaaaaggtgtctcttgta
back to top
>AM411488.1-BRP.m1665
ctcacccagttagtctataaccatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatctttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaaacagttccaatgagttggaaattttat
tgggatgtatcgagacacatgttaagaataagaagttactcattgttctagatgatgtgtggaccgaagacaaaacaaag
tgggaaaatttgaaactaccagtaataatgcagagttgtgctcagggtagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaatgatgagagcaaccagcaacatgatccatttggacaagttgagcgatagggattgtctagcattgttca
atagctttgcatttttggatagggaagaagatgaggctaatgggtttggagctattggtgaggaaattgtgaaaaagtgt
aaaggtttgcctcttgctgcaaagactttaggcagtctagtgtggtataagaaaacaagagaggaatggcgggatgttct
gaatagtaagatatgggaactagaagaagttgaacaacaagttttccgaccactattactaagttattatgatttggctc
ctgcagtcaaaaggtgtcttttgta
back to top
>AM411487.1-BRP.m1665
ctcgcccagttagcctataaccatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaagcagttccaatgagttggaaatcttat
tgggatgtatcgagacacgtgttragaataagaagttactccttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccgataataatgcagagttgtgctcagggtagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccagcagcatgatccatttggacgagttgagcggtagggattgtctggctttgttca
atagctttgcgtttttggatagggatgaagatgaggctgacgggttgggagctattggtgaggaaattgtgaaagggtgt
aaaggtttgcctcttgctgcaaagactttaggtagtctastgtggtataagaaaacaagagaggaatggcgggatgttct
gaagagtgagatatgggaactagaagaagttgaggaacaagttttccgaccactgttgctaagttattatgatttggccc
ctgcagtcaaaaggtgtcttttgta
back to top
>AM411486.1-BRP.m1664
cttgcccaattagcctataacaatgaaaatgttacagcccattttgataagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcattgaaaatctagatggatcccaaagcagttccaatgagttggaaattttat
tgggatgtatcaagacacgtgttgagaataagaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccaataataatgcaaagttgtgctaagggcagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtttggctttgttca
atagcatcgcgtttttggatagggaagaaaatgaggctggtgagttgggagatattggtaagaaaattctgaaacggtgt
aaaggtctgcctcttgctgtaaagactttaggtagtctattgtggtataagaaaacaagaaaggaatgggaggatgttct
gaagagtgagatatgggaattagaaaaagttgagcaaaatgttttccgaccactattattaagttattatgatttggccc
ctgctgtcaaaatgtgtcttttgt
back to top
>AM411485.1-BRP.m1643
cttgccaagttggtctacaatgatgaaatggtcgttgggcatttcgatttgcggatgtgggtgtatgtgtcagtggactt
tgatattcataggctgatggaaaagatccttagttctgcactaggtaaagaaatcagtgagaaaatgtctgtggatcaat
tacaagcaaagttacgtgagtcattgaaggataagaaatatttgcttgtcttggatgatgtatggaatgaggatcgtagt
caatggagtgacttgagaaatttgttgatagacgggatcaaattaggaagtaaaatcttagtgacaacccgtaatctctc
agttgcttcaatcatgggcactgaacaaccatacaatttagctggcctttcttatgagtattgtttgtcattgtttacaa
aatgtgcattcaaggaaggtgatgagaaacagcatccacacctctttgaaattggaaaagagattgtgaagaagtgcgga
ggggctccgttggcggtgagaactttagggagtcaactgtactcagagactgatgagcgtcgatggaaattagtaagaga
ttctaagatatgggaattggagagagggagtggtcatatcttgcctgctttgagattgagttatattcaattgccttcat
acc
back to top
>AM411484.1-BRP.m1664
ctcacccaactagtctttaacaatgaaaaggttgcagcccattttgacaagaaagtttgggtttgtgtctcggatccttt
tgatgagattaagattgctaaagcgatcactgaaaatctagatggatcccaaagcagttccaatgagttggaaattttat
tgggatgtatcaagacacgtgttgagaataagaagttacttcttgttctagatgatgtgtggaccgaagacgaaacaaag
tgggaaaatttgaaactgccaataataatgcaaagttgtgctaagggcagtacaatactggtgaccacacgaaaagaagg
ggttgctaaaattatgagagcaaccaacaacatgatccatttagatgagttgaattataaggattgtttggctttgttca
atagcattgcgtttttggatagggatgaagatgaggctgatgagttgggagatattggtaagaaaattgtgaaacggtgt
aaaggtttgcctcttgctgcaaagactttaggtagtctactgtggtataagaaaacaagaaaggaatgggaggatgttct
gaagagtgagatatgggaattagaaaaagttgagcaacatgttttccgaccactgttgcttagttattatgatttggccc
ctgcagtcaaaaggtgtcttctat
back to top
>AM411483.1-BRP.m1642
acgacacttgctcgagctatccatgatcaaatttgtcagcattttgaccaaagctgctttctttccaatgttagagaaat
ttctaaaaacaatggcctagtttctctacaagaaaaacttctttccaggatcctgatagcaaaagttaaaaatatagagg
atgaatacacaggagctgctatgataaaaaggcggttgtgtaggaaaaaggtgcttgttgttattgatgatgtggatcag
ttgacacaattagagaaattggctggaaatcgcaactggtttggtccagggactagaattatcataaccaccacagattt
tcagttgttaaaggcacatgctgttgatgctacgtacaaggctaacggcttaaactgtgatgaagcacttcaacttttga
gtttgaaggcttttaagaaatgtcccccaccaaaagattatttgcatctgtgctacgatgttatagggtatgctaagggg
cttccgttggctctcgtggtcttaggttcttttctatttggtagaagcgctgatgaatgggcaagtgcaatagataggct
aaagaacacaccagataaacgcattattgaggtgcttcggattagttttgatggacttgatgaaaaagacaaagaaatat
tc
back to top
>AM411482.1-BRP.m1465
atggttagagcattgtctgagagaatctctcatgaatttgaatttagtttccttcttaccgatgttacagactccgtcaa
aagaagtggtttgcttattctacaaaagcaacttctctctaggatttgtacaaaaacggatgacatatcagacgtccttg
aaggagccaccataataatgaggttgttaggcaacaaaaaagttcttctcattctcgatgatgtgaaccattcaagccat
ttaaagtatttggcaggaaaccaagagtggtttggttcagggagtagagttctcatcacaactagagatgagcatttgtt
gatcgaacatgaagtggagagaagattgaaggttgaggaacttaatgatgaggattctcttatgcttttcagccggaaag
cattcaaaaaaggttaccctgaaaaagattttcttggtttgtctaaatctttcataaattatgcc
back to top
>AM411481.1-BRP.m1632
atggtaagagcggtgtatgcgagaatctctcgtgaattcgaatttagtttcattcttactgatgttagaaagtccgttga
agaaaggggtctacttaagttacaaaagcaacttctctctgcgatttggacaaagaaggccagcttatcagaccctcatg
aaggagccgactttataaggaggttgttaggtcacaaaaaagttcttcttgttcttgatgatgtgaaccatccaagccat
ttaaaatatttggcaggaaaccaagactggtttggttcagggagtagagtgcttatcacaactagaaatgagcatttgtt
gattcaacatggagtgaagacaagattgaaggtcgaagaattaaaccatgatgattctcttaagctttttagctggaaag
cattccaaagaggttaccctgaagaagattttcatggtttgtcagagtctgttataaattatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttacgtggaagggatctaagtgaatggaacagtgcactgagaaaactgggaagagt
ttgtaacttggaaatctttgacatacttaaaataagttacaatgatctagattctgaagagaagaaaatatt
back to top
>AM411480.1-BRP.m1632
atggtaagagcggtgtatgcgagaatctctcgtgaattcgaatttagtttcattctaactgatgttagaaagtccgttga
agaaagtggtctacttaagttacaaaagcaacttctctctgggatttggacaaagaaggccaagttatcagaccctcatg
aaggagccacctttataaggaggttgttaggtcacaaaaaagttcttcttgttcttgatgatgtgaaccatccaagccat
ttaaaatatttggcaggaaacaaagactggtttggttcagggagtagagtgcttatcacaactagaaatgagcatttgtt
gattcaacatggcgtggggagaagattgaaggtcgaagaattaaatgatgatgattctcttaagctttttagctggaatg
cattcgaaagaggtgaccctgaagaagattttcttggtttgtcagaatcttttgtaagttatgccaaaggtcttcctcta
gctcttgaagtactgggttcttttttgcatggaagggatctaattgaatggaacagtgcactgagaaaactgggaagagt
ttgtaacttggaaatctttgacatacttaaaataagttacgacggtcttgattctgaagacaagacaatatt
back to top
>AM411479.1-BRP.m1465
atggtaagagcggtgtatgagagaatctctcgtgaatttcaattcagtttccttattaccgatgttagaaactccgttga
aaatggtggtttacttaatctgcaaaagcaacttctctctgggattggggcaaaaaaggctgacatattagacctgcatg
aaggagccaccatattacagaggttattacgtcacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttaaaatatttggcaggaaaccaagagtggtttcgttcagggagtagagttcttatcacaactagaaatgagcatttgtt
ggttcaacatggagtggagagaagattgaaggtcgaagaattaaaccatgatgattctcttacgctttttagctggaaag
cattccaaagaggttaccctgaagaaggttttcatggtttgtcagagtctgttataaattatgcc
back to top
>AM411478.1-BRP.m1632
atggtaagagcggtgtatgagagaatctcttgtcaatttgaatttagtttccttcttaccgatgttagagactctgttga
aaaaagtggtctacttaatctacaaaagcaacttctctctgggatttggacaaaaaaggcagacgtatcagaccttcatg
aaggagccaccataataaggaggttgttgggtcacaaaaaagttcttctcattcttgatgatgtgacccatttaagccat
ttgaaatatttggcaggaaaccaagattggtttggttcagggagtagagttctcatcacaactagaaatgagcatttatt
gatcgaacatggagtggagagaagattgaaggttgagggatttgatgatgaggattctcttcagcttttcagctggaaag
cattcaaaagaggttaccctgaagaagattttcttgctttgtcaaaatctgttataaactatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttgtatggtagagatctaagtgaatggaagagtgcattgaaaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgaagagaagaatatttt
back to top
>AM411477.1-BRP.m1635
actatggtaagagcggtgtatgagagaatctctcgtgaatttgaatttagtttccttcttaccgatattagagactccgt
tgaaaaaagtggtttacttaatctacaaaagcaacttctctctgggatttggacaaaaagggccgacattttagaccttc
atgaaggagccaccataataaggaggttgttaggtcacaagaaagttcttctcattcttgatgatgtgatccgttcaagc
catttgaaatatttggcaggaaaccaagattggtttggttcagggagtagagttctcattacaactagaaatgagcattt
attgatcgaacatggagtcgagagaagattgaaggttgaggaatttaatgatgaggattctcttcagcttttcagctgga
aagcattcaaaagaggttaccctgatgaagattttcttgatctgtctaaatctgtcataaattatgccaaaggtctccct
ttagctcttgaagtactgggctcttttttgcatggaagagatctaagtgaatggaacagtgcattgagaaaactaggaag
agtttgtaacttggaaatttttgacatacttaaaacaagttatgatggtctagatgatgaagagaagaaagtatt
back to top
>AM411476.1-BRP.m1630
atggtaagagcggtgtatgagagaatctctcgtgaatttgaatttagtttccttcttactgatgttagaaactttgttga
aaaaagtggtctacttaatttacaaaagcaacttctgtctgggatttggacaaagaagtccaacatatcagaccttcatg
aaggagccatgattataaggaggttgtttggtgacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttagaatatttggcaggaaacccagagtggtttggttcagggagtagagttcttatcacaactagaaatgagcatttgtt
gattggacatggagtggagagaagattgaaggtcgaagaattaaatgatgctgattctcttcaggtttttagccggaaag
cattcaaaagagtttaccctgaaggagattttcttggtttgtcagaatatgttataagttatgcaaaaggtgttccttta
gctcttgaagtactgggttcttttttgcatggaagagatcttagtgaatggagaagtgcactgagaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaacgatctggattctgaagagaagaaaata
back to top
>AM411475.1-BRP.m1633
atggtaagagcggtgtatgagagaatctctcatgaatttgaatttagtttccttctttccgatgttggaaactccgttga
aaaaggtggtctacttaatctacaaaagcaacttatctctagtatttggacaaaaaaggctgacatatcagaccttcatg
aaggagccaccatactaaggaggttgttaggtcacaaaaaagttcttctcattcttgatgatgtgaaccattcatgccat
ttaaaatatttggcaggaaaccaagagtggtttggttcggggagtagagttcttatgacaactagaaatgagcatttgtt
gattgaacatggagtggagagaagattgaaggctgaagaattaaatgatcaggattctcttcagctttttagctggaaag
cattcaaaagaggataccctgaagaagattttcttggtttgtcagaatctgttataagttatgccagaggtcttccttta
tctcttgaagtactgggctcttttttgtatggaagagatctaagtgaatggaatagtgcattaagaaaactacgaagagt
ttttaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgcaagagaagaaaatatt
back to top
>AM411474.1-BRP.m1632
atggtaagagcggtgtatgagagaatctctcatgaatttgaatttagtttccttcttaccgatgttagagactccgttga
aaaaagtggtttacttattctacaaaagcaacttctctctgggatttggacaaaaaaggctgacatttcagacctttatg
aaggagccaccaaaataaagaggttgttaggtcacaagaaagttcttctcattcttgatgatgtgacccattcaaggcat
ttgaaatatttggcaggaaaccaagagtggtttggtttagggagtagagttcttatcacaacaagaaatgagcatgtatt
gattgaacatggtgtggagagaagattgaaggtcgaagaattaaatgatgacgattctcttcagcttttcagctggaaag
cattcaaaagaggttaccctgaagaagattttcttgctttgtcaaaatctgttataaactatgccaaaggtctgccttca
gctcttgaagtactgggttcttttttgtatggaagagatctaagtgaatggaagagtgcattgaaaaaactgggaagagt
ttgtaacttggaaatttttgacatacttaaaataagttacaatgatctagattccgaagagaagaatatttt
back to top
>AM411473.1-BRP.m1547
gatgttagaaactcctccgttgaaaaaggtggtttacttaatctgcaaaagctacttctctctgggattggggcaaacaa
cgctgacatatttgaccttcatgtaggagccaccatattacagaggttattatgtcacagaaaagttcttctcattcttg
ataatgtgaaccattcaagtcatttaaaatatttggcaggaagccaagagtggtttggttcagggagtagagttcttatc
acaagtagaaatgagcatttgttgattgaacatggagtggagttaagattgaaggtcgaagaattaaatgatgatgattc
tcttcaactttttagccagaaagcattcaaaagaggtttccctgaagaagattttcttggtttgtcagaatctgttacaa
gttatgccaaaggtcttcctctagctcttgaagtactgggttcttatttgtatggaagagatataagtgaatggaagagt
gcattgagaaaactaggaagagtttgtaactcggaaatctttgacatacttaaaataagttacgaca
back to top
>AM411472.1-BRP.m1632
atggtaagagcggtgtatgagagaatctcttgtgaatttcaattcagtttccttattactgatgttagaaactccgttga
aaatggtggtttacttaatctgcaaaagcaacttctctctgggattggggcaaaaaaggctgacatattagaccttcatg
aaggagccaccatattacagaggttattacgtcacaaaaaagttcttctcattcttgatgatgtgaaccattcaagtcat
ttaaaatatttggcaggaaaccaagagtggtttggttcagggagtagagttcttatcacaactagaaatgagcatttgtt
gattcaacatggagtggagagaagattgaaggtcgaagaattaaaccatgatgattctcttaagctttttagctggaaag
cattccaaagaggctaccctgaagaggattttcatggtttgtctgagtctgttataaattatgccaaaggtcttccttta
gctcttgaagtactgggttcttttttgtatggaagagatccaagtgtatggaacagtgcactgacaaaactgggaagagt
ttgtaacttggaaatttttgacacacttaaaataagttacaatgatctagattccgaagagaagaaaatttt
back to top
>AM411471.1-BRP.m1470
attgcccaagtggtttatgaaagggtacaagctcagttcgaaggttgcagctttcttgataatgtgagagagcagataac
tgaaaaacaaggtgcagttcatttacagcagcaacttctttcggatttgctgaaatgtagtgtaaatgtacagaacacta
aaacaggaaaaaagataatgaggcagagactaagtactaaaatggttcttatcattcttgatgatgtggacaaagaaaaa
caattggaagcattgtgtgatagggaatcggttggtccaggcagtagaatcatcataacttgtagagatgaacatttgct
cagtgtagttgaaggagacaaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaag
ccctcaagaaagaccagctggttggaaaagaaattctgaagctatccaaagaattgttgaaatatgctaa
back to top
>AM411470.1-BRP.m1635
attgcacaagtggtttttgaaaggctaagagctcagtttgaaggtgatagctttcttgagaatgttaaacaggaaactga
aatgaagcaaggtagtacaattcatttacaagagaaacttctcttgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaatgggaaaagacataattaagcatagactatctactaaaagagtgcttgttgttcttgatgatgtggatcaagat
aaacaattggaaacattgtgtggtcgtacttggtttggtccagggagtagaatcatcataacttccagagatgaacacct
gattagtgcatttggagcagataaagtatacaaggtgaatgcattaactgatcctgaagcttttgagctctttcatttga
aagccttcaatgaagacgaggttggagaagattttctcaagctatccaaggaatttttgaaatatgctaattgccttcca
ttagctattaaaattttgggatcgtctgtttgtggtagaagtgtaaagttatggtcaagtgaattgaagagacttgaaaa
aaatcctccgaaaaagatttttgatgttcttaaatttagttttgatggattacaagaaacagaaaagaaaacgtt
back to top
>AM411469.1-BRP.m1634
attgcacaagtggtttttgaaaggctaagagctcagtttgaaggtgatagctttcttgagaatgttaaacaggaaactga
aatgaagcaaggtagtacaattcatttacaagagaaacttctcttgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaatgggaaaagacataattaagcatagactatctactaaaagggtgcttattgttcttgatgatgtggatcaagat
aaacaattggaaacactgtgtgatcgtacttggtttggtccagggagtagaatcatcataacatccagagatgaacactt
gatcagtgcatttggagcagacgaagtatacagggtgaatgcattaactgagcctgaagctttggagctctttagtttga
aagccttcaaggaagacgaggttggagaagattttctcaagctatccaaggaatttttgaaatatgctaatggccttcca
ttagctattgaagttttaggatcgtccgttcgtggtagaagtgcaaagatatggttaagtgcattgaatagacttaaaaa
aaaccctgaaaaagggattattaatgttcttaaagtcagttttgatggattagaagaaacagaaaagaaaacgt
back to top
>AM411468.1-BRP.m1635
ttgcacaagtggctttttgaaagggtaaaagctcagtttgcaggtgatagctttcttgagaatgttaaagaagaaactga
aaagaagcaaggtagtacaattcatttacaagagaaacttctattgaacttgctgaatagtaatgtcaatgtacagaaca
ctaaaacgggaaaagacataattaagcatagactatctgctaaaagagtgcttgttgttcttgatgatgtggatcaagat
aaacaattggaaacattgtgtgatcgtacttggtttggtccagggagtagaatcatcataacatccagagatgaacactt
gatcagtgcatttggagcagataaagtatacaaggtgaatgcattaactgatcctgaagcttttgagctctttagtttga
aagcctttaaggaagacaaggttggagaagattttctcaagctatcaaaggaatttttgaaatatgccaatggccttcca
ttagctattgaagttttgggatcgtctgttcgtggtagaagtgtaaagttatggtcaagtgcattgaagagacttaaaaa
gaatcctcaaaaagggattattgatgttcttaaagttagttttgatgaattagaagaaagagaaaagaaaacgtt
back to top
>AM411467.1-BRP.m1465
attgcacaagtggtttttgaaagggtacaagctcagtttgatggttgcagctttcttgagaatgttagagaggtaattga
aaagcaaggtgcagtgcatttacaagagcaacttctttcgaatttgctgagatttagtgtaaatgtacagaacactaaaa
tgggaaaaaatataatgaggcagaggctacattctaaaacggttcttatcattcttgatgatgtggaccaagaagaacaa
ttggaagcattgtgtgatagggaattgtttggtctagggagtagaatcatcataacttctagagatgaacatctgctcag
tgcagttgaaggagataaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaagcct
tcaagaaagaccagctggttggagaagattttctgaagttatccaaagaatttttgaaatatgct
back to top
>AM411466.1-BRP.m1467
attgcacaagtggtttttgaaagggtacaagctcagtttgatggttgcagctttcttgagaatgttagagaggtaattga
aaagcaaggtgcagtgcatttacaagagcaactgctttcgaatttgctgagatttagtgtaaatgtacagaacactaaaa
tgggaaaaaatataatgaggcagaggctatgtactaaaatggttcttctcattcttgatgatgtggaccaagaagaacaa
ttggaagcattgtgtgatagggaatcgtttggtccagggagtaggatcatcataacttctagagatgaacatttgctcag
tgcagttgaaggaggtaaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaagcct
ttaagaaagaccagctggttggagaagaaattctgaagctatccaaagagtttttgaaatatgctaa
back to top
>AM411465.1-BRP.m1465
attgcacaagtggtttttgaaagggtacaagctcagtttgaaggttgcagctttcttgagaatattagagaggaagcaga
aaagcaaggtgcaattcatttacaaaagcaacttcttttgaactttctgaaatgtaatgtaaatgtacagaccactaaaa
tgggaaaagatataatcagacgtagactatgtactaaaagggttcttctcattcttgatgatgtggatcaagaagaacaa
ttggaagtattgtgtaatcgcacttggtttggtccagggagtaggatcatattaacatcaagagatgaacacttgctcag
tgcatttggagtggataaagtatacaaggtgaatccattaactgctgccgaagctcttgagctctttggtatgaaagcct
ttaagaaagaccagctggttggggaagattttctcgagctatccaaggaatttttgaaatatgct
back to top
>AM411464.1-BRP.m1465
attgcacaattcgtctttgaaagggtacgggctcagtttgaaggttgcagctttcttgagaatgttagagaggtaactga
aaagcaaggtgtggttcatttgcaagagaaacttctcttgaacttgctgaatagtaatgacaatgtacagtacactaaaa
tgggaaaagacataattaagcatagactatctactaaaagggtgcttgttattcttgatgatgtggaccaagaagaacaa
ttggaagcgttgtgtgataaggaatcgtttggtccagggagtagaatcatcataacttgtagagatgaacatttgctcag
tgcagttgaaggagataaagtatataaggtgaatccgttaactgatgctgaagctcttcagctcttcagtatgaaagcct
tcaagaaagaccagcaggttgggaaagaatttctcaagctatccaagaaatttttgaaatatgct
back to top
>AM411463.1-BRP.m1469
attgcacaagaggtttttgaaagggtacaagctcagtttgaaggttgcagctttcttgagaatgtgagagagcagataac
tgaaaaacaaggtgcagttcatttacaacagcaacttctttcggatttgctgaaatgtagtgtaaatgtacagaacacta
aaacaggaaaaaagataatgaggcagagactaagtactaaaatggttcttatcattcttgatgatgtggacaaagaaaaa
caattggaagcattgtgtgatagggaatcggttggtccaggcagtagaatcatcataacttgtagagatgaacatttgct
cagtgtagttgaaggagacaaagtatataaggtgaatccattaactgatgctgaagctcttcagcttttcagtatgaaag
ccttcaagaaagaccagctggttggaaaagaaattttgaagctatccaaagaattgttgaaatatgcta
back to top
>AM411462.1-BRP.m1640
attgcaaaagctgtttacaacttaattgctcgtaagtttgaaggttgttgtttcttggcaaatgttagtgcagcttcagt
accctatcaaggcctagttcaactacaaaatgagcttctttatgagattttaggggggcggaaaatggagatgactaatg
ctgatagaggaatccaggtgataaaggaaagattgggtagtaaaagggttctcttagttctagatgatgtgaatgaattg
aaccagttggacaaattagctggaggattggattggtttggttgtggcagcagaattatcataacaacgagagataaacg
tttgctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctcttgattt
tgaatgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctttactctatactcactgc
cttccattagctgtgaacattttaggttcatttctctgtggtatgagtataaatcaatggcatactgcattggatggtta
cagaagatttcctaacggcgatatccaaaaagtccttgaaacaagttacgatgcattggaatatccattgaaagaagcat
back to top
>AM411461.1-BRP.m1647
acgacaattgctaaagctgtttacaactcaattgccagtaagtttgaaggttgttgtttcttgggaaatgttagagcaaa
ttcaataccccatggaggcctagttcggctacaaaataatcttctttatgagattttaggggaccggaaagtgaagatga
ccgatgctgataggggaatccaggtgataaaggaaaggttaggtagtaaaagggttctcttagtcattgatgatgtgaag
gaattgaaccagttggacaaattagctggaggattggattggtttggtcgtggcagcagaattatcataacaacaagaga
taaacatttgctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctct
tgattttgaatgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctttactctatact
cactgccttccattagctgtgaacattttaggttcacatctctgtggtaagagtataaatcaatggcatgctgcattaga
taattacagaaagtttcctaattgcgatatccaaaaagttctcaaaacaagttacagtgcattggaagatcctttgaaag
aagcatt
back to top
>AM411460.1-BRP.m1636
gctaaagctgtttacaactcaattgccagtaagtttgaaggttgttgtttcttgggaaatgttagagcaaattcaatacc
ccatggaggcctagttcggctacaaaataatcttctttatgagattttaggggaccggaaagtgaagatgaccgatgctg
ataggggaatccaggtgataaaggaaaggttaggtagtaaaagggttctcttagtcattgatgatgtgaaggaattgaac
cagttggacaaattagctggaggattggattggtttggtcgtggcagcagaattatcataacaacaagagataaacattt
gctaattgctcatcaagtctatccaatatacacagccaaggcattagataatgatgaagcccgtaacctcttgattttga
atgccttcaaggataacagaaatccagatgagtgtgtgcaattcccaattgatactgctctactgtatgctcacggcctt
ccattagctgtaaacattttaggttcacttctctgtggtaagggtataaatcaatggcatgctgcattagatggttacag
aagatttcctaacagcgatatccaaaaagtccttcaaacaagttacaatgcattggaagatccgttgaaagaagca
back to top
>AM411459.1-BRP.m1573
agagaagtctcggcaggacccaagggcttggtatctcttcaaaacaaactcatcgcagatctttcccccagtaaggtgcc
tgtgaatgaccttgagactggtatttctgcgattaaggcacttgtatgtgatgagcgagttcttgttgttctggatgatg
ttgataatgtaaaccaactaagtgctttagttggcaaaggacaatggtttaatgaaggaagccgaattatcattaccaca
cgagatagaggactattacccagttatcttgtgaattataagttgtatgaggtcagggagttggatgtgtcccaggcact
gcaactgtttagttaccatgcactgagaagagatagacccacagataatttcttgagtctgtccgaggaaattgtgtctc
ttacaggtgggctaccgttagctcttgaagtatttggttcttttctatttgataagaggagaatagaggaatggacagat
gctctgggcaaactgactaagattcgaccgcaacatcttcaggatgtgttgaagataagttatgatgcactagacgagca
agagaagtgtatc
back to top
>AM411458.1-BRP.m1579
cttgccaaggctatttttaataaacttgttggtcattttgggggacacagtttcgtctcaaatgttagagaagtctcggc
aggacccaagggcttggtatctcttcaaaacaaactcatcgcagatctttcccccagtaaggtgcctgtgaatgaccttg
agactggtatttccgcgattaaggcacttgtatgtgatgagcgagttcttgttgttctggatgatgttgataatgtaaac
caactaagtgctttagttggcaaaggacaatggtttaatgaaggaagccgaattatcattaccacacgagatagaggact
attacccagttatcttgtgaattawaartkgtatgaggtcagggagttggatgtgtcccaggcactgcaactgtttagtt
accatgcactgagaagagatagacccacagataatttcttgagtctgtycgaggaaattgtgtctcttacaggtgggcta
ccgttagctcttgaagtatttggttcttttctatttgataagaggagaawagargaatrgacarawgctctgggcaaamt
gactaagattcgaccgcca
back to top
>AM411457.1-BRP.m1640
acttgccaaggctatttttataaacttgttggtcattttgggggacacagtttcgtctcaaatgttagagaagtctcggc
aggacccaagggcttggtatctcttcaaaacaaactcatcgcagatctttcccccagtaaggtgcctgtgaatgaccttg
agactggtatttctgcgattaaggcacttgtatgtgatgagcgagttcttgttgttctggatgatgttgataatgtaaac
caactaagtgctttagttggcaaaggacaatggtttaatgaaggaagccgaattatcattaccacacgagatagaggact
attacccagttatcttgtgaattataagttgtatgaggtcagggagttggatgtgtcccaggcactgcaactgtttagtt
accatgcactgagaagagatagacccacagataatttcttgagtctgtccgaggaaattgtgtctcttacaggtgggcta
ccgttagctcttgaagtatttggttcttttctatttgataagaggagaatagaggaatggacagatgctctgggcaaact
gactaagattcgaccgcaacatcttcaggatgtgttgaagataagttatgatgcactagacgagcaagagaagtgtatct
back to top
>AM411456.1-BRP.m1644
acacttgccaaggctatttttaataaacttgttggccattttgggggacacagtttcgtctcaaatgttagagaagtctc
ggcaggaccaaagggcttggtatctcttcaaaacaaactcattgctgatctttcccccggtacggtgtctgtgaatgacc
ttgagactggtatttctgcaattaaggcagttgtatatgataagcgagttcttcttgttctggatgatgttgataatgta
aaccaactaagtgctttagttgacaaaggacaatggtttaatgaaggaagccgaattatcattaccacacgagatagagg
actattacccagttatcttgtgaattataagttgtatgaggtcagggagttggatgtgtcccaggcactacaactgttta
gttaccatgccctgagaagagatagacccacagataatttcttgagtctgtccgagaaaattgtgtctcttacaggtggg
ctaccgttagctcttgaagtatttggttcttttctatgtgataagaggagaataggggaatgggaagatgctttgcgcaa
actgactaagattcgaccgcaacatcttcaggatgtgctgaagataagttatgatgcactagacgagcaagagcagtgta
tctt
back to top
>AM411455.1-BRP.m1635
attgcaaaattagtttacaattcaaattttgaaaagtttgatggaagcagctttcttgagaatataagacaattttcgga
gctacctaatggcttagttttaatacaaacaaaacttctttgtgatattgggaaaaaggtggaaatacacagcgttagtg
agggaatacctaggattgaaaaggtcttgcgctctaaaagagttcttcttgttcttgatgatgtggatcatacggaccaa
ctagatgcagtgcttatgatgcaagataagtttcatccaggaagtagaatcatcataacaactaggcatgcgaggttgtt
gaatgttgatagagctattgaggtctataaccttgaaactttggatttcgatgactcactgaagctcttcagttggcatg
ctttcggacggaactatcctaataaaggttacatggaacattcaaaaaggctagtgcaccatagtggaggtcttccatta
gctctaaaagtttttggttcttccctatcgaggcaaagtatagatgtatgggaaagtgcattagagaaattggaagtaat
tccaaatggtgaaatcatgaacaaactcaaaataagctatgactctttacaagacagccatgacaaagatttatt
back to top
>AM411454.1-BRP.m1448
cttgcacaagctttttatgataaaatctctgatcagtttcgagataaatgctttctgaaaaatgttagagagatttctag
acgagacggtattgttgcattaacaaaagatctcctttgcaatgtcttaaaaaggatggatgtgtgtgatagtgaggtaa
ggcatagatttcgtcgtaaaaaggttctcattattctggatgatgtagataagttggaacaattgcaagcattagctgga
agcaacaattggtttggtcgagggagtaggatcattataacaaccagggacgaacagttgttgatagctcatcatgtgga
tagaagttacaaggtcaaggaattgaaaagtgatgatgcactgaagctatttagttggaaagctttcaggagtgcgcatc
ccccagaagattatttggagttatcccataactttgtaaattactgta
back to top
>AM411453.1-BRP.m1627
attgctagagctgtttatgacgaaattgtttgtcaatttgaacactattgctttcttgaaaatgtcaaggaaggtttcaa
gcataatggtgccatacatatgcaggaagaacttctatctaggatttttgagaaaagcgtgcgcagtctaggcactttga
gtagaggttccaagatgataatggataggctgagtaagaaaaaagttctgcttgttcttgatgatgtagagaactttaac
cagattgaagagttacttggaaagcagcattcatttggtagagggagtagaatcattgtaaccactagggatatacaatc
actcagtggagttaatgagagatatagtcccatgtttctaagcgatggtgaagctcttgaactttttttgcagtatgcct
tcagaacaaaccaacctacgagagagtatgatcctctctcaaggcgtgctgtagaatatgctcaaggtctacctttagca
ctcaaagttttgggagctagtcttgatggcaaaagtatatgtgagtgggaagatgagctggagaaaataaaggaaatccc
gcataaggaaattcagggtgtgcttaggacaagctttgacggactggatccttcacagcaggaaatc
back to top