BSH, BSH (gene) Prunus persica

Gene Overview
Name BSH
Gene Symbol BSH
Type gene
Organism Prunus persica
Synonym bushy growth protein
Description NA
Comment BSH; a conserved subunit of plant SWI/SNF complexes; 434509
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BSHKM398337.1-BSH.m1Prunus persicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
Bushy plantsBSHPrunus persicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM398337.1-BSH.m1 scaffold_1:21244034..21246820
KM398337.1

Sequence(s):
>KM398337.1-BSH.m1675
aagttcaggatgccgacagcccagaatttagtaccgattcgcttggacctcgatgtcgatggccaaaagtttaaagacac
tttcacttggaacccatctgaccctgactcagagattgtggtgtttgcgagaaggacagcaaaagacttgaagcttcctc
cgggtttcattacagtcatggcttctgccattcagattgcagactttcggtcgttggaaggccaagatatgtacccgggc
gagaggattgtgccaattaagcttgatcttcgagtgaaccatactcttattagggaccagtttttgtgggacttgaacaa
ctttgaaagtgatcctgaagagtttgctaaaacattctgcgcagatttaggtattcaagatcctgaagtggggcctgcaa
ttgccttttcaattagggaacaactgtatgagattgcagttcaaagtgtagcatcagcaagagaaaacagaataagcaaa
aagggacgccgaggggctgagtatactccagtcagtaaagcaggtagtactggattggacctggtgaagttattcggtca
caaatctagtgttgttcggaaaaggaaggagtgggatgtatacgaacccattgttgatcttctatctagcgaggaagtgg
atgcccttcaagcgaaagaagaaaggcttactcgg
back to top