BZIP1, BZIP1 (gene) Malus x domestica

Gene Overview
Name BZIP1
Gene Symbol BZIP1
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP1HM122462.1-BZIP1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122462.1-BZIP1.m1 Chr07:12466483..12471523
chr11:11239675..11244718
chr11:12239678..12244721
HM122462.1

Sequence(s):
>HM122462.1-BZIP1.m12568
atggggtgtacggcgtcgaaattggacaacgaggacactgtgaggcggtgcaaggagcggcgccgcctcatgaaagacgc
cgtctacgctcgccaccacttggccgctgcccacgccgactactgccgttccctccgccttaccggctctgccctcgtct
ccttcgccgccttcgagcctctctctatctcccaccaaacccctgccgtcttcctccaccaagtcccccctcccaccacc
aaccacatccctccacgtgccccctcccccgctccctcctccctccacccgccaccacctcctccgcctctctctcccac
catcaacagctccaacctcccccacatcctttcctcctcctccgcccactcctctcgccaacatcgccgccgccgccagc
cgccgccgaagcttcctcacatactgtcggaatcgagtcttccttcttcccctggaagtcagaagtcgaatttcagcaac
ccttttgggtttccgtcggctttccaggcggagtcgaactactcgaggacgccgtcgcaggcctcctccatgtggaactg
ggaaaatttctaccctccatcgccgccggactctgagttcttcgagcaacgccaaaaaagccaaacgcaatcccgccagc
accaaaaatcgccccaccacctcgacccggaacattccgacgagaacgattcagagacggaggcgatagaggcggagccg
ctcgagaccgaaaccgaaagatcggagtacgatttcttcctcaaccatcgaaacccaaaagcccagaatgcccatcatca
aaataggcacgagtacgctcagtcggagaagtacgcgccgtcgcagaagtacgcccattccgagaaatacgctcagtcgg
agaagtacgcgccctcgcagaagtacgcccattccgagaaatacgctcaatcggagagggaggaggtgcagtgcagtgag
tgggacgaccacgaccacgaccactacagcacgacgagctcctctgacgaaggggacgacgagagggagtcgagatccga
gatgggtacccggtcgactttcgagccggaatcggttcgggccgagtcggtggccggttcgggccgggttccggtggctc
aggcgatgccgcggtatgcaccaagcacgagcaagtcggagaggtcggaggggtcggagggcgggagcacttaccggagc
agtgagatctccaatatgaagatggtggtgaggcacaaggatttgaaggagattgtggaggcgattaaggagaatttcga
cagggccgcaaccgccggcgaccaagtttccgagatgctcgagaccagccgggcccagctcgaccggagcttccggcagc
taaagaagacagtgtaccactccagtagtgtgctgagcagtttgagctctacttggagttcaaaaccgccgctggcggtc
aagtaccgcctggatgctggctcgctcaacagcgagcccggcggttcaaagagcctctgctccaccttcgaacggctctt
ggcctgggagaagaagctctatgaggaagtcaaggccagagaaggagtcaagattgagcacgagaagaagctgtccgcac
tgcaacatcaagagtacaagggggaggacgaaaccaaagtagacaagaccaaggcgtcgataaagaggctgcaatcacta
atcattgtcacatctcaggccgtctctaccacctccaccgccatcattgatcttagagactccgatctcgtgcctcaact
tgttgaactgtgccacgggttcatgtacatgtggagatcaatgcaccagtaccatgaagtccagaacgacattgtacaac
aggtcaggggacttgtgaaccgatcagcgaagggtgactcaacttcggaactacatcggcaggcaacacgtgaccttgaa
tcagctgtctctgcctggcactccagtttctgccgtttaataaagttcaaacgggactttatccggtctgttcatggttg
gttcaagctcacccttcttcctgtaaacaacgacatgactttcaatgtgcacaatgaatcttctgatgtatattccttct
gtgatgagtggaagcttgcacttgagcgcgtccctgacacagtagcttctgaggctatcaatagctttatcaatgttgtc
cacgtaatctctgtgaaacagagtgaagagctcaagatcaaaaaacgcactgaaactgcgtcaaaggagcttgagaaaaa
ggcttcttctctccgaaacattgaaaagaaattctaccactcctactccatggttggtattgggcttcctgactcggggc
ctgaaaatgggcaggttttggatgcgcgagatcctcttgctgagaagaaatctgaacttacaacctgccagaggcgggtt
gaagatgagatgatgaggcatacaaaggcggtggaggtgacaagagccatgactctaaacaatcttcaaacaggcttgcc
aggagtatttcaggcactgaccagctttgctggcctatttacggaggcacttgagtcggtttgtacacgttcctacgcca
tcaaatag
back to top