BZIP2, BZIP2 (gene) Malus x domestica

Gene Overview
Name BZIP2
Gene Symbol BZIP2
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP2HM122472.1-BZIP2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122472.1-BZIP2.m1 Chr15:27661741..27664909
chr15:25920770..25923937
chr15:25927718..25930886
chr15:29269793..29272960
HM122472.1

Sequence(s):
>HM122472.1-BZIP2.m11881
atgaagttcatgaaacttggatcgaaaccggatttctttcagaccgatggagacactataaggtacgtcacaactgagtt
ggcaactgacatagctgttaatgtcggagatgtgaagttctatttgcataagtttcctcttttgtccaagagtgcacgcc
tgcagaaactggttgcaaccacaaatgaaaacagcgatgaaatccacatccatgatattcctggtggacctgctgctttt
gaaatatgtgccaagttctgttacggcatgactgtcactctcaatgcatacaatgtggttgcaactcgatgcgcagcaga
gtatctggagatgtacgaaactattgagaaaggaaacctagtctacaaggttgaagtgttcctaaactctagcgtcttcc
ggagctggaaagactcgattattgttcttcagactacgaggtctcttgtaccatggtccgaggaagttaaggtggtgagc
cactgccttgattccatagcttccaaggctaccattgatacttccaaggttgaatggtcgtatatgtataaccacaagaa
actaccatctaatgggaatgattcacactggaatggagtggcaaaacaacagatggttccgaaagactggtgggtggaag
acctctgtgggcttcaacttgatttatacaagcaggtgataacaataatcaagaccaaaggaaaaatctctggtgatgta
ataggggaagcgttaaaggcatatattaccagaaggttgtcagattttagcaagggcatgattcagggcgatgttgtaaa
gaataaatcattggtggagactgtaatccacttactccctgcacgcagtgtcccttgcagtttcttacttaaattgttaa
aagcggcaagactgttagaatgtggagaagtcgaaaaatgtgagttaattcgcaaaattggccagcagcttgacgaggct
acagtttctgatcttttgattcaacccccaactgatgaaacaataaaatatgaagttgacatggtgcaaagcctaattga
agagtttgtgacacacaatcgaagtgctcagactgatccttcaatggaaaccgaattccaggagattagaagtcccaggt
tatcagatacttccaaggtgaaggtggccaagctggttgacagctaccttactgagatttcatgtgatcccaacttacct
gcgtcaaagtttgtccatcttgctgaaatggtatcaagcttctcaagaccaactcatgatggactttaccgtgccattga
catgtatctaaaggaacacccagggatcagcaagggtgagaagaagagaatgtgcaaattaatggactgcaggaagttgt
cagtagatgcctgcatgcatgctgtgcaaaatgagcggctacccttaagagtcgttgcgcaggtactcttctttgaacag
attagggcttcagcgtccggtggcagcaccagtatacctgatctgcaaggctccatctgggccttactcccaggtgggtc
tcatgggagctcaaggtcaaccacaaccaacacagaagacgactgggatgatgtgccgacagcagaagaaatcaaggctt
taaaatgtgagattttcactcctaggctaggcgaagtgaatggaggagttggcagtgatagaaatgggaaccccggtgct
acaaaaaatcttgaaaaagttccatctggtaaagtgaaaggtatgatcatgtcgaaaaagatattttctaagctgtggtc
aagcaaagaaagcagtggtgaaatcagcagttgtaatacatcagagagccctggttcttctcgcaatgcagaagaaaaaa
agtccacccgttcgaggagtaggaggaattcgctgtcttag
back to top