BZIP9, BZIP9 (gene) Malus x domestica

Gene Overview
Name BZIP9
Gene Symbol BZIP9
Type gene
Organism Malus x domestica
Synonym BZIP domain class transcription factor
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIP9HM122482.1-BZIP9.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM122482.1-BZIP9.m1 Chr13:3790225..3790840
chr13:3386463..3387078
chr13:3375249..3375864
HM122482.1

Sequence(s):
>HM122482.1-BZIP9.m1615
atgcttccaggtgagatcatttcaggactccactactttgaacctgaaatcccacttccaaatccctctgactttgcctt
catgcagaaccaaattccctccctccatttcaacacttcgttcaacaacttatcccgtcaaatcgctcctcctataggcc
atgacttcactcaacaatcctccagcctcagcaacaactccagcacctctgacgacgccgaagaacaccaccacctcaga
gtcatcgacgagaggaagcataggagaatgatatccaacagagaatcagcccgtagatcgcggatgaggaagcagaagca
cctcgacgagctctggtcgcaggtggtccggctgaggaatgagaaccacagcctgatagacaggttgaacaacctttcgg
agtcccacgacatggttgtggaggagaatgctcggctcaaggaagaagcttgtgaccttcgccaaatgctcacaaacctg
cagattggcagcccttacaatataaatgcttctaccttcagagagctggagggagaggtgccctgcaacacggctcatct
cagagccgagtcatcgaaccaatccatcgctgcatcggccgatttgctccattaa
back to top