BZIP, BZIP (gene) Pyrus pyrifolia

Gene Overview
Name BZIP
Gene Symbol BZIP
Type gene
Organism Pyrus pyrifolia
Synonym bZIP protein
Description NA
Comment dormancy-related protein
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
BZIPKC951877.1-BZIP.m1Pyrus pyrifoliamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
BZIP domain class transcription factorBZIPPyrus pyrifoliagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KC951877.1-BZIP.m1 scaffold00508:175583..182352
KC951877.1

Sequence(s):
>KC951877.1-BZIP.m11230
atgggtagcagtgagatggacaaaccctctaaagagaaagagaaggagacaaagacaacacccgctagtacgcaggagca
gtctgcgactaccagtgctggtgctgttaatcctgagtggtcgggatttcaggcatattctccaatacctccacatggat
ttatggcttcaagtccgcaagctcacccctatatgtggggggttcagcatattatgccaccctatagtacccctccgcac
ccatatgttgcaatgtatccccatggtggcttatatgctcacccgtctatgcctcctggatcttatccttttagcccgtt
tgctatgcctactccaaatggtattgtagaggcttctggtaacacacctgggagcatggaagcagagggtaagccatctg
aggtcaaggacaaattaccaataaaacgatcaaaaggaagcttgggcagtttgaatatgattacagggaagaataacgag
cttggcaaaacatcaggagcctctgctaatggagtttattccaaaagtgctgagagtgctagtgatggtacaagtgaagg
aagtgatgcaaattctcagagtgattcacaattgaagtctggggtcaggcaagattctttggaaggtgatgtatctcaga
atggcagttctgcacatggttctcaaaatggagcaccaaacacacataccatgttgaatcagacgatggccgtcatgcca
ataacggctgctggtgctcctggcgttgttcctggtcctgcaactaacttaaatattgggatggattattggggagctcc
accttctgccgccatgcctgcaatgcgtgggaaggttgcaaccactccagtatcagcaggaatagttactgctgggtctc
gggatagtgttcagtcacagctttggttacaagatgagagagagcttaaaagacagaaaagaaagcagtcaaatagggaa
tccgctcgtcgatctaggttgcgcaagcaggcggaatgcgatgagctggccctgcgtgctgaagccttaaaagaggaaaa
tggcactcttagatcagaagttaaccggatcaggagcgagtatgagctgcttctctcagagaatgcctctctaaaggaga
ggcttggagaaattcctggtcatgaagatgtacggtctgccagaagtgaaccacatttgagcaatgacactaaacagatt
gcacaaacagaacggcatggcggcctgtag
back to top