C4H, C4H (gene) Fragaria chiloensis f. patagonica

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Fragaria chiloensis f. patagonica
Synonym cinnamate 4-hydroxylase
Description NA
Comment cytochrome P450s oxidase; conversion of cinnamate into coumarate; phenylpropanoid pathway; trans-cinnamate 4-monooxygenase
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HDQ898278.1-C4H.m1Fragaria chiloensis f. patagonicamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HFragaria chiloensis f. patagonicagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database DQ898278.1-C4H.m1 LG3:20085808..20088310
DQ898278.1

Sequence(s):
>DQ898278.1-C4H.m1853
accgtttacggtgagcactggaggaaaatgaggaggataatgacggttcctttcttcaccaacaaggtggtgcagcagta
ccgccacggctrggagtcggaggcggcggcggtggtggaggacgtgaagaaacaccccgaggccgccaccagcgggatgg
tgttacgtaggaggctgcagctgatgatgtacaacaacatgtacaggatcatgttcgacaggagatttgaaagcgaggag
gatcctctgttcgtgaaactgaggggtttgaatggagagaggagccgacttgcgcagagttttgagtataattacggtga
ctttattcccgtgctccggccgttcctccgagggtacctgaagatctgtaaggaggtgaaggagaagaggattcagctct
tcaaggactatttcgtcgatgagagaaagaaacttgcaagcacacaggtcacaactaatgaaggattgaagtgtgccatt
gaccacatcctggacgctcaacagaaaggagagatcaacgaggacaatgtcctttacatcgtcgagaacattaacgtcgc
cgccattgaaactacactatggtcaatcgagtggggaatagccgagcttgtgaaccaccccgaaatccagaagaagctga
gggatgagctcgacactgtcctaggccatggagttcaagtcacagaacccgaacttcacaagctaccgtaccttcaagcc
gtggtgaaggaaaccttaaggcttcgcatggcgatccccctcctcgtcccacacatgaacctccacgatgccaagctcgg
agggttcgacattccagcggagagcaagatcttggtgacgcttggtggctggc
back to top