C4H, C4H (gene) Malus hybrid cultivar

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Malus hybrid cultivar
Synonym cinnamate-4-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HJQ248935.1-C4H.m1Malus hybrid cultivarmRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HMalus hybrid cultivargene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly JQ248935.1-C4H.m1 Chr11:4506063..4509736
chr11:4614885..4618880
chr11:5206188..5210183
JQ248935.1

Sequence(s):
>JQ248935.1-C4H.m11515
atggacctcctcctcctggaaaagacccttctgggtctcttcgtcgccgtcatcgtcgccatcgccatttcgaaactccg
cggcaagaaattcaagctcccgccgggtcccatacccgtacccgtattcggaaactggctccaggacggtgacgacctca
accaccgcaacctcaccgacatggccaagaaattcggcgactgcttcctcctccgcatggggcagcgcaacctcgtcgtc
gtctcctcgccggagctggccaaggaggtcctccacacccagggagtcgaattcgggtcgaggacccgaaacgtcgtctt
tgatattttcaccggtgaaggccaggacatggtgttcaccgtctacggcgagcactggcggaaaatgcggcgtatcatga
ccgtccccttcttcaccaacaaggtcgtccagcagtaccgctacggatgggaatcggaggcggcggcggtcgtcgaggat
gtgaaaaagcaccccgaggcggcgaccagcggaatggtgctgcggaggcggctgcagctgatgatgtacaacaacatgta
cagaattatgttcgaccggcgattcgagagcgaggaggatcccctgttcgtgaagctcaaggcgctcaatggggagagga
gccgattggcgcagagcttcgattacaactacggcgactttatcccgatcttaaggccgtttttgagagggtatttgaag
atctgcaaggaagtgaaggagaagaggattcagctgtttaaggactatttcgtggacgagaggaagaaactttcgagcac
aaagcctacaacaaacgaagggttgaaatgcgccatcgatcacatcctcgacgcgcagcagaaaggagaaatcaacgagg
acaacgttctctacatcgtcgagaacatcaacgttgctgctattgaaaccacgttgtggtcgatcgagtggggaattgcc
gagctagtgaaccaccccgaaatccagaagaagttgaggaatgaactcgacacagtcctcggccgcggagttcagatcac
agagcccgacgttcctaaacttccctacctgcaagccgtggtcaaggagactctccgacttcgcatggcaatcccgctcc
ttgtcccccacatgaacctccaggatgccaagctcggcgggtttgatattccggcggagagcaagatattggtgaatgct
tggtggttggcgaacaaccctgccctgtggaagaagccagaagagtttaggcccgagaggtttttggaggaggagtcgaa
ggtggaggctaacgggaacgacttcaggtatctcccgtttggtgttgggaggagaagttgtcctgggattattttggcac
tgccaatcctgggcattacaattggacgtatagtccagaacttcgagcttctgcctccgccaggacagtccaagctcgac
acctcggagaaaggtggacaattcagcctgcacatcctgaagcactccaccattgtgatgaagccgagggcgtag
back to top