C4H, C4H (gene) Prunus armeniaca

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Prunus armeniaca
Synonym cinnamate 4-hydroxylase
cinnamate-4-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HHM204477.1-C4HPrunus armeniacagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HHM204477.1-C4H.m1Prunus armeniacamRNA
C4HJQ622235.1-C4H.m1Prunus armeniacamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HPrunus armeniacagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database HM204477.1-C4H N/A HM204477.1
mRNA parsed from NCBI nr database HM204477.1-C4H.m1 scaffold_6:2187090..2189969
HM204477.1
mRNA parsed from NCBI nr database JQ622235.1-C4H.m1 N/A JQ622235.1

Sequence(s):
>HM204477.1-C4H2754
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgtcatcgtcgcaatcactatttcgaagctccg
tggcaagcggttcaagctcccgcccggtccgatacccgtaccagttttcggaaactggctccaggtcggcgacgacctca
atcaccggaacctcaccgacctcgcgaaaaagttcggcgacatcttcctcctccgcatggggcagcgcaatttggtggtg
gtctcgtcccctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcgaggacacgaaacgtcgtgtt
cgatattttcaccggtgagggccaggatatggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga
ccgttcctttcttcactaacaaggtcgtgcagcagtataggcacggctgggaatcggaggcagcggcggtggttgaggac
gtgaagaagtacccggggtctgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtacaacaacatgta
ccggattatgttcgatcggaggttcgagagcgaggaggatcctctgtttatgaagctcaaggggttgaatggggagagga
gccgattggctcagagcttcgattacaattatggagattttatccccattttgagacccttcttgagaggctacttgaag
atctgcaaagaggtcaaggagaagagaattcggctgttcaaggactactttgttgatgaacggaagtaagattttttttt
ttttttacttaattcaattttgttatttatgttgaaaaacattagtgtctaattagtaaaagataaaaatgaaactgtta
ctggaactctaatttgtcgtcctgcattgaaaaagaaacgaataagaatgacaaactgatagtgtaaataagtattactg
gtcaaatataccacgttagtagcatgagtattatgaatggtttccttttttgggtctaatggaaattttttttttccact
ttcaaaatatgtgaagttttctatttttatagaatatttgattatatctgaaatgaaatttgattttaattgttgagcag
gaaactttcaagcacaaaaacgacaacaaatgaaggactgaagtgcgccatcgaccatatcctggacgctcagcagaagg
gagagatcaacgaggacaacgtcctttacatcgtcgagaacatcaacgttgctggtaagtggggccctcacttccctagt
ctcctaatttttaccacagcaacacagtgccatgcatttttactgctttacccaattttttcgagaggttattatgggaa
atgccaatggcgcttctcttaaaattttcacatgatttatgcagaacaaacaaaaaataaatcctataaaacttaccgtt
cataattgcaagcctgcgaaattcggtgcccttgtcgccggtgtttattgtgaggataaattttttgacctgttcttcca
ctcttttattttatattttcttacaaataatattacaattaatcctagattttatttaaatcgcaattaaaacattaacg
ggtctagttgagtgaaaaagtgaattgacatgcagattagagggcttaagttcgaaccccataatatcttggttacaaga
caaaattgattatttcaacgccaacttagaactcattttaagtatttaagttattttcaactctattttaacccaaacca
ttggttgtcctgcatcgtgacatgattccttttcaggttaggtgataaatatttgtttaaatctgaatatgtcaaatcca
ctttattaggtgcatctaggtgaacaaaacatgtggcttcaatgttaatacatacaacctagcaactttcttgggtttcc
ttataatgatggaaacatacacatcttatcctctacattagttaaacttcattttatgtacaatccactttcttcttgcc
aacccctgtgacattgactgccaactcactttccatttggacactacagattaatcacagtctgatatatgtgcataaac
tttactctttgtaattttaataacgtatctaactcgttacagataatcagagtctaatatattttttttgattaacagca
attgaaacaacactatggtcaattgagtgggggattgcagagcttgtgaaccaccctgagatccaaaagaagctgaggga
tgagcttgactcagtgcttggccctggtgttcaaatcacagagccagagatccagaagcttccctaccttcaagctgtga
tcaaagagactctcaggcttcgcatggcaatcccattgcttgtcccacacatgaatctcaacgatgcaaagctgggcagc
tacgacattccagcggagagcaagatcctggtgaatgcatggtggctggcaaacaaccctgccctctggaagaagcctga
ggagtttaggccagagaggtttttggaggaagaggccaaggttgaggccaatggcaatgactttaggtaccttccatttg
gtgttgggagaagaagctgtccagggattattttggcccttccaattcttgggatcactttgggacgtttagtccagaac
tttgagctcttgcctcctcctggacagtccaagcttgacaccacagagaaaggtgggcagttcagcttgcacattttgaa
gcactctaccattgtgttgaagccaaggtcatag
back to top
>HM204477.1-C4H.m11515
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgtcatcgtcgcaatcactatttcgaagctccg
tggcaagcggttcaagctcccgcccggtccgatacccgtaccagttttcggaaactggctccaggtcggcgacgacctca
atcaccggaacctcaccgacctcgcgaaaaagttcggcgacatcttcctcctccgcatggggcagcgcaatttggtggtg
gtctcgtcccctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcgaggacacgaaacgtcgtgtt
cgatattttcaccggtgagggccaggatatggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga
ccgttcctttcttcactaacaaggtcgtgcagcagtataggcacggctgggaatcggaggcagcggcggtggttgaggac
gtgaagaagtacccggggtctgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtacaacaacatgta
ccggattatgttcgatcggaggttcgagagcgaggaggatcctctgtttatgaagctcaaggggttgaatggggagagga
gccgattggctcagagcttcgattacaattatggagattttatccccattttgagacccttcttgagaggctacttgaag
atctgcaaagaggtcaaggagaagagaattcggctgttcaaggactactttgttgatgaacggaagaaactttcaagcac
aaaaacgacaacaaatgaaggactgaagtgcgccatcgaccatatcctggacgctcagcagaagggagagatcaacgagg
acaacgtcctttacatcgtcgagaacatcaacgttgctgcaattgaaacaacactatggtcaattgagtgggggattgca
gagcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgactcagtgcttggccctggtgttcaaatcac
agagccagagatccagaagcttccctaccttcaagctgtgatcaaagagactctcaggcttcgcatggcaatcccattgc
ttgtcccacacatgaatctcaacgatgcaaagctgggcagctacgacattccagcggagagcaagatcctggtgaatgca
tggtggctggcaaacaaccctgccctctggaagaagcctgaggagtttaggccagagaggtttttggaggaagaggccaa
ggttgaggccaatggcaatgactttaggtaccttccatttggtgttgggagaagaagctgtccagggattattttggccc
ttccaattcttgggatcactttgggacgtttagtccagaactttgagctcttgcctcctcctggacagtccaagcttgac
accacagagaaaggtgggcagttcagcttgcacattttgaagcactctaccattgtgttgaagccaaggtcatag
back to top
>JQ622235.1-C4H.m1609
gcagcggcggtggttgaggacgtaaagaagtacccggggtctgcgaccaatgggatggtgctgcggaggcggttgcagct
gatgatgtacaacaacatgtaccggattatgttcgatcggaggttcgagagcgaggatgatcctctgtttatgaagctca
aggggttgaatggggagaggagccgattggctcagagcttcgattacaattatggagattttatccccattttgagaccc
ttcttgagaggctacttgaagatctgcaaagaggtcaaggagaagagaattcggctgttcaaggactactttgtcgatga
acggaagaaactttcaagcacaaaaacgacaacaaatgaaggactgaagtgcgccatcgaccatatcctggacgctcagc
agaagggagagatcaacgaggacaacgtcctttacatcgtcgagaacatcaacgttgctgcaattgaaacaacactatgg
tcaattgagtgggggattgcagagcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgactcagtgct
tggccctggtgttcaaatcacagagccagagatccagaagcttccctac
back to top