C4H, C4H (gene) Prunus cerasifera x Prunus munsoniana

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Prunus cerasifera x Prunus munsoniana
Synonym cinnamate 4-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HHM204478.1-C4H.m1Prunus cerasifera x Prunus munsonianamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HPrunus cerasifera x Prunus munsonianagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM204478.1-C4H.m1 scaffold_6:2187090..2189969
HM204478.1

Sequence(s):
>HM204478.1-C4H.m11515
atggacctactcctcctggaaaagaccctcctgggtctcttcatcgccgtcatcgtcgcaatcactatttcgaagctccg
tggcaagcggttcaagctcccgcccggtccgatacccgtaccagttttcggaaactggctccaggtaggcgacgacctca
accaccggaacctcaccgacctcgcgaaaaagttcggcgacatcttcctcctccgcatggggcagcgcaatttggtggtg
gtctcgtcccctgacctcgccaaggaggtcctccacacccagggcgtcgaattcgggtcgaggacacgaaacgtcgtgtt
cgatattttcaccggggagggccaggatatggtgttcacggtctacggtgagcactggaggaagatgaggcggatcatga
ccgttcctttcttcactaacaaggtcgtccagcagtataggcacggctgggaatcggaggcagcggcggtggttgaggac
gtgaagaagtacccggggtctgcgaccaatgggatggtgctgcggaggcggttgcagctgatgatgtacaacaacatgta
ccggattatgttcgatcggaggttcgagagcgaggaggatcctctgtttatgaagctcaaggggttgaatggggagagga
gccgattggctcagagcttcgattacaattatggagattttatccccattttgagacccttcttgagaggctacttgaag
atctgcaaagaggtcaaggagaagagaattcggctgttcaaggactactttgttgatgaacggaagaaactttcaagcac
aaaaacgacaacaaatgaaggactgaagtgcgccatcgatcatatcctggacgctcagcagaagggagagatcaacgagg
acaacgtcctttacatcgtcgagaatatcaacgttgctgcaattgaaacaacactatggtcaattgagtgggggattgca
gagcttgtgaaccaccctgagatccaaaagaagctgagggatgagcttgactcagtgcttggccctggtgttcaaatcac
agagccagacatccagaagcttccctaccttcaagctgtggtcaaagagactctcaggcttcgcatggcaatcccattgc
ttgtcccacatatgaacctcaacgacgcaaagctgggcagctacgacattccggcggagagcaagatcctggtgaatgca
tggtggctggcgaacaaccctgccctctggaagaagcctgaggagtttaggccagagaggtttttggaggaagaggccaa
ggttgaggccaatggcaatgactttaggtaccttccatttggtgttgggagaagaagctgtcccgggattattttggccc
tgccaatccttgggatcactttgggacgtttagtccagaactttgagctcttgcctcctccaggccagtcccagcttgac
accacagagaaaggtgggcagttcagcctgcacattttgaagcactccaccattgtgttgaagccaaggtcatag
back to top