C4H, C4H (gene) Pyrus x bretschneideri

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Pyrus x bretschneideri
Synonym cinnamate 4-hydroxylase
cinnamic acid 4-hydroxylase-like protein
Description NA
Comment C4H
similar to INSD ABD77493.2 cinnamic acid 4-hydroxylase [Arnebia euchroma]
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HKF663548.1-C4H.m1Pyrus x bretschneiderimRNA
C4HHQ901370.1-C4H.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KF663548.1-C4H.m1 scaffold00442:28347..32677
KF663548.1
mRNA parsed from NCBI nr database HQ901370.1-C4H.m1 scaffold00442:28347..32677
HQ901370.1

Sequence(s):
>KF663548.1-C4H.m11515
atggacctcctcctcctggaaaagacccttctgggtctcttcgtcgcggtcatcgttgccatcaccatttcaaaactccg
cggcaagaaattcaggctcccgccgggtcccatccccgtacccgtattcggaaactggctccaggtcggtgacgacctca
accaccgcaatctcaccgacatggccaagaaattcggcgactgcttcctcctccgcatggggcagcgcaacctcgtcgtt
gtctcctcgccggagctcgccaaggaggtcctccacactcagggagtcgaattcgggtcgaggacccgaaacgtcgtctt
tgatattttcaccggtgaaggccaggacatggtgttcaccgtctacggcgagcactggcggaaaatgcggcgtatcatga
ccgtccccttcttcaccaacaaggttgtccagcagtaccgctacggatgggagtcggaggcggcggcggtcgtcgaggat
gtgaaaaagcatcccgaggcggcgaccagcggaatggtgctgcggaggcggctgcagctgatgatgtacaacaacatgta
cagaatcatgttcgaccggcgattcgagagcgaggaggatcccctgttcgtgaagctcaaggcgctgaatggggagagga
gccgattggcgcagagcttcgactacaactacggcgattttatcccgatcttaaggccctttttgagagggtatttgaag
atctgcaaggaagtgaaggagaagaggatccagctgtttaaggactatttcgtggacgagaggaagaaactttcgagcac
aaagccgacaacaaacgaagggttgaaatgcgccatcgaccacatcctcgacgcgcagcagaaaggagaaatcaacgagg
acaacgttctctacatcgtcgagaacatcaacgttgctgctattgaaaccacattgtggtcgatcgagtggggaattgcc
gagctagtgaaccatcccgaaatccagaagaagctgaggaatgaactcgacacagtccttggccgcggagttcagatcac
agagcccgacgttcataaacttccctacctgcaagccgtggtcaaggagactctccgacttcgcatggcaatcccactcc
ttgtcccccacatgaacctccaggatgccaagctcggtgggtttgatattccggcggagagcaagatactggtgaatgct
tggtggttggcaaacaaccctgccctgtggaagaagccagaagagtttaggcctgagaggtttttggaggaggagtcgaa
ggtggaggctaacgggaacgacttcaggtatctcccgtttggtgttgggaggagaagttgtcctgggattattttggccc
tgccaatcctgggcattacaattggacgtttagttcagaacttcgagcttctgcctccgccaggacagtccaagctcgac
acctcggagaaaggtggacagttcagcctgcacatcctgaagcactccaccattgtgatgaagccgatggcgtag
back to top
>HQ901370.1-C4H.m11515
atggacctcctcttcctggaaaagacccttctgggtctcttcgtcgcggtcatcgttgccatcaccatttcaaaactccg
cggcaagaaattcaggctcccgccgggtcccatccccgtacccgtattcggaaactggctccaggtcggtgacggcctca
accaccgcaatctcaccgacatggccaagaaattcggcgactgcttcctcctccgcatggggcagcgcaacctcgtcgtc
gtctcctcgccggagctcgccaaggaggtcctccacactcagggagtcgaattcgggtcgaggacccgaaacgtcgtctt
tgatattttcaccggtgaaggccaggacatggtgttcaccgtctacggcgagcactggcggaaaatgcggcgtatcatga
ccgtccccttcttcaccaacaaggtcgtccagcagtaccgctacggatgggagtcggaggcggcggcggtcgtcgaggat
gtgaaaaagcaccccgaggcggcgaccagcggaatggtgctgcggaggcggctgcagctgatgatgtacaacaacatgta
cagaatcatgttcgaccggcgattcgagagcgaggaggatcccctgttcgtgaagctcaaggcgctgaatggggagagga
accgattggcgcagagcttcgactacaactacggtgattttatcccgatcttaaggccctttttgagagggtatttgaag
atctgcaaggaagtggaggagaagaggatccagctgtttaaggactatttcgtggacgagaggaagaaactttcgagcac
aaagcctacaacaaacgaagggttgaaatgcgccatcgaccacatcctcgacgcgcagcagaaaggagaaatcaacgagg
acaacgttctctacatcgtcgagaacatcaacgttgctgctattgaaaccacattgtggtcgatcgagtggggaattgcc
gagctagtgaaccatcccgaaatccagaagaagctgaggaatgaactcgacacagtccttggccgcggagttcagatcac
agagcccgacgttcataaacttccctacctgcaagccgtggtcaaggagactctccgacttcgcatggcaatcccactcc
ttgtcccccacatgaacctccaggatgccaagctcggtgggtttgatattccggcggagagcaagatactggtgaatgct
tggtggttggcaaacaaccctgccctgtggaagaagccagaagagtttaggcccgagaggtttttggaggaggagtcgaa
ggtggaggctaacgggaacgacttcaggtatctcccgtttggtgttgggaggagaagttgtcctgggattattttggccc
tgccaatcctgggcattacaattggacgtttagtccagaacttcgagcttctgcctccgccgggacagtccaagctcgac
acctcggagaaaggtgggcagttcagcctgcacatcctgaagcattccaccattgtgatgaagtcgagggcgtag
back to top