C4H, C4H (gene) Rubus occidentalis

Gene Overview
Name C4H
Gene Symbol C4H
Type gene
Organism Rubus occidentalis
Synonym cinnamate-4-hydroxylase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
cinnamate 4-hydroxylaseC4HRubus occidentalisgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
C4HFJ554629.1-C4H.m1Rubus occidentalismRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database FJ554629.1-C4H.m1 N/A FJ554629.1

Sequence(s):
>FJ554629.1-C4H.m11515
atggatctcctcctcatggagaagaccctcttggggctcttcgtagccgtcgtcgtcgccataaccgtatccaagctccg
cggcaagaaattcaagctcccccctggtccgatacccgtccccgttttcggcaactggctccaggtcggcgacgacctga
accaccgcaatctgaccgaaatggccaagaaattcggcgaagtgttcatgctccgtatggggcagcgcaacctcgtcgtc
gtgtcatcgccggacctcgccaaggaggtcctccacacgcagggagtcgagttcgggtcgaggacccgaaacgtggtctt
cgacatcttcaccggaaaaggacaggacatggtgttcaccgtctacggcgagcactggcgcaaaatgcggcggatcatga
cggtcccgttcttcacgaacaaggtggtccagcagtaccgttacgggtgggaatcggaggccgcggcggtggtggaggac
gtgaaaaagcacccggaggcggcgaccaatgggatggtgctacgtaggcggctgcagcttatgatgtacaacaacatgta
caggatcatgttcgatagaaggttcgagagcgaggacgacccgttgttcgtgaaattgaagggtttgaacggagagagga
gccgattggcgcagagcttcgagtacaactacggcgatttcattccggtgctcagacccttcttgaggggttacttgaag
atctgtaaggaagtgaaggagaagagaattcagctgttcaaggactatttcgttgatgagagaaagaaactttcaagcac
acaagccacaactaacgaagggttgaagtgtgccattgaccacatcttggacgctcagcagaaaggagagatcaacgagg
acaacgtcctttacatcgtcgagaacattaacgttgccgcaattgaaaccacactatggtcaatcgagtggggaattgcc
gagcttgtgaaccaccctgaaatccagaagaagctgagggatgagctcgacactgttcttggccgtggtgttcaaatcac
ggagcccgaaattcaaaaactgccgtacctccaagccgtggtgaaagagactctaaggcttcgcatggcaatccctctcc
tcgtcccacacatgaatctccacgacgcaaagctcggtggctttgacattccagctgagagcaagatcttggtcaatgct
tggtggcttgcaaacaaccctgcacactggaagaagcccgaggagttcaggcccgagaggtttttggaagaagagtccaa
agttgaggccaatggtaatgacttcaggtaccttccgtttggtgttgggaggaggagttgtcccgggattattttagcac
ttccgattctcgggattactttgggacgtttggtccagaactttgagctcttgcctcctccaggacagactcaacttgac
acgacagagaaaggtggacaatttagtctgcacatcttgaagcattccaccatagtcatgaagccaaggacataa
back to top