CAM1, CAM1 (gene) Pyrus x bretschneideri

Gene Overview
Name CAM1
Gene Symbol CAM1
Type gene
Organism Pyrus x bretschneideri
Synonym calmodulin 1
Description NA
Comment CaM1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CAM1KJ008979.1-CAM1.m1Pyrus x bretschneiderimRNA
CAM1JN177304.1-CAM1.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calmodulinCAMPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KJ008979.1-CAM1.m1 scaffold03213:3273..4988
KJ008979.1
mRNA parsed from NCBI nr database JN177304.1-CAM1.m1 scaffold03213:3273..4988
JN177304.1

Sequence(s):
>KJ008979.1-CAM1.m1450
atggcggatcaactgaccgacgatcagatctctgagttcaaggaagccttcagtctattcgacaaggatggagatggctg
tatcacaactaaggagcttggcactgtcatgagatcattggggcagaacccgactgaggcagagctccaggacatgatca
atgaagtggatgctgatggtaatgggaccattgactttcctgagttcttaaacctcatggccaggaagatgaaggacacg
gactctgaggaggagctgaaagaggctttcagagtgtttgacaaggatcagaatggcttcatttcagctgcggagctccg
ccatgtgatgaccaatcttggggagaagctcacagatgaggaagtggatgagatgatccgggaggctgatgttgatgggg
atgggcagataaattatgaggagtttgtcaaggtgatgatggctaagtga
back to top
>JN177304.1-CAM1.m1450
atggcggatcaactgaccgacgatcagatctctgagttcaaggaagccttcagtctattcgacaaggatggagatggctg
tatcacaactaaggagcttggcactgtcatgagatcattggggcagaacccgactgaggcagagctccaggacatgatca
atgaagtggatgctgatggtaatgggaccattgactttcctgagttcttaaacctcatggccaggaagatgaaggacacg
gactctgaggaggagctgaaagaggctttcagagtgtttgacaaggatcagaatggcttcatttcagctgcggagctccg
ccatgtgatgaccaatcttggggagaagctcacagacgaggaagtggatgagatgatccgggaggctgatgttgatgggg
atgggcagataaattatgaggagtttgtcaaggtcatgatggctaagtga
back to top