CAM, CAM (gene) Malus x domestica

Gene Overview
Name CAM
Gene Symbol CAM
Type gene
Organism Malus x domestica
Synonym calmodulin
Calmodulin
CA
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CAMX60737.1-CAMMalus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CAMJN941576.1-CAM.m1Malus x domesticamRNA
CAMX60737.1-CAM.m1Malus x domesticamRNA
CAMX60738.1-CAM.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calmodulinCAMMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly X60737.1-CAM Chr14:13844162..13845473
chr14:15924248..15925559
chr14:19286756..19288067
X60737.1
predicted genes from whole genome assembly JN941576.1-CAM.m1 Chr14:13844319..13845542
chr14:15924405..15925628
chr14:19286913..19288136
JN941576.1
predicted genes from whole genome assembly X60737.1-CAM.m1 Chr14:13844162..13845473
chr14:15924248..15925559
chr14:19286756..19288067
X60737.1
predicted genes from whole genome assembly X60738.1-CAM.m1 Chr14:13844162..13845473
chr14:15924248..15925559
chr14:19286756..19288067
X60738.1

Sequence(s):
>X60737.1-CAM1310
atggcggatcagctgactgacgatcagatctctgagttcaaggaggccttcagccttttcgacaaggatggcgatggtta
gactcagatctctctcttccgaatttccatccattttttacaattatattttgcatgttatttacatgttttgattcctt
tatctatgtcagatctgcatcttggatttctggttttggatcttcgatttataattggagaattgtagatcctcgatttt
gatttttaaattcggcttttgctttttatattttgtttcgtggaattattacttgcgtttgtgaaaatcgaaaacagatt
gaaaagggggttgcgatgatcgattcaaattttcaattttcaaagaggtttaatcttgtgtttgagtgttattagggttt
gtgatttgtaaaaaaagggaaattaattccggaactttgtgattgttgacataaatctgaacatgtcaagcatgtgtaag
aaatttgagatttatttttctcttgcagaaaatatgagattcaaggattgtcattgtatgatatttgttgaatgcttgat
gggttagtttcttagaatgtccatgataggctggtatggttcttgtcgtgtgcgttctttattactctcgatgctaggaa
atttaaaattcatgtgcgctcttttggatcaggttttcatacttgcgaataccatgcttttaaatgtttgtttgcgctcg
tgtgtgtattggacaaacggtgttatgtttgcttggtgaactaatgcaaaatgggcgctggtttccagtgtctcaaagga
tatggaatgccaatacttttctgtatgtagtatgtagtcccgatatctgcatatcttgtgttcctcataagcaaacataa
gcacccagaagaaatagaagcaacttatcgccgtttctaataattttgatatgcaggttgtatcaccacaaaggagcttg
gcactgtcatgagatcattggggcagaacccgactgaggctgagctccaggacatgatcaatgaagtcgatgctgatggt
aatgggaccattgactttcctgagcctttaaacctcatggccaggaagatgaaggacactgactctgaggaggagctgaa
agaggctttcagagtttttgacaaggatcagaatggcttcatttccgccgcggagctccgccatgtgatgaccaatcttg
gggaaaagctcactgatgaggaagttgatgagatgatccgggaggctgatgttgatggcgatggccagataaattacgag
gagtttgtcaaggtgatgatggccaagtga
back to top
>JN941576.1-CAM.m1362
tcccctctctctctgctccctaatttccaagagaaaaggaaaacacaaagaagaaatcaagggggatcgatggcggatca
gctgactgacgatcagatctctgagttcaaggaggccttcagccttttcgacaaggatggcgatggttgtatcaccacaa
aggagcttggcactgtcatgagatcattggggcagaacccgactgaggctgagctccaggacatgatcaatgaagtcgat
gctgatggtaatgggaccattgactttcctgagttcttaaacctcatggccaggaagatgaaggacactgactctgagga
ggagctgaaagaggctttcagagtttttgacaaggatcagaa
back to top
>X60737.1-CAM.m1450
atggcggatcagctgactgacgatcagatctctgagttcaaggaggccttcagccttttcgacaaggatggcgatggttg
tatcaccacaaaggagcttggcactgtcatgagatcattggggcagaacccgactgaggctgagctccaggacatgatca
atgaagtcgatgctgatggtaatgggaccattgactttcctgagcctttaaacctcatggccaggaagatgaaggacact
gactctgaggaggagctgaaagaggctttcagagtttttgacaaggatcagaatggcttcatttccgccgcggagctccg
ccatgtgatgaccaatcttggggaaaagctcactgatgaggaagttgatgagatgatccgggaggctgatgttgatggcg
atggccagataaattacgaggagtttgtcaaggtgatgatggccaagtga
back to top
>X60738.1-CAM.m1450
atggcggatcagctgactgacgatcagatctctgagttcaaggaggccttcagccttttcgacaaggatggcgatggttg
tatcaccacaaaggagcttggcactgtcatgagatcattggggcagaacccgactgaggctgagctccaggacatgatca
atgaagtcgatgctgatggtaatgggaccattgactttcctgagttcttaaacctcatggccaggaagatgaaggacact
gactctgaggaggagctgaaagaggctttcagagtttttgacaaggatcagaatggcttcatttccgccgcggagctccg
ccatgtgatgaccaatcttggggaaaagctcactgatgaggaagttgatgagatgatccgggaggctgatgttgatggcg
atggccagataaattacgaggagtttgtcaaggtgatgatggccaagtga
back to top