CAM, CAM (gene) Malus pumila

Gene Overview
Name CAM
Gene Symbol CAM
Type gene
Organism Malus pumila
Synonym calmodulin
Description NA
Comment calcium ion binding
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CAMHM369505.1-CAM.m1Malus pumilamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calmodulinCAMMalus pumilagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM369505.1-CAM.m1 N/A HM369505.1

Sequence(s):
>HM369505.1-CAM.m1450
atggccgatcagctcaccgacgatcaaatctccgaattcaaggaagcttttagtctctttgacaaggacggcgatggttg
catcactaccaaggagctagggactgtaatgcggtcactggggcagaacccaaccgaggctgagctccaggatatgataa
atgaggttgatgctgatggtaatggaaccattgactttcctgagtttctaaaccttatggccagaaagatgaaggacact
gattccgaggaggagcttaaggaggccttcagggttttcgacaaagatcagaatggattcatctctgctgctgagctccg
ccatgtcatgacaaatcttggggagaaacttactgatgaagaagttgaagagatgatccgtgaagctgatgttgatggtg
acgggcagatcaactatgaagagtttgtcaagattatgatggcgaagtga
back to top