CAM, CAM (gene) Prunus avium

Gene Overview
Name CAM
Gene Symbol CAM
Type gene
Organism Prunus avium
Synonym calmodulin
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
calmodulinCAMPrunus aviumgene_class


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CAMAF292108.1-CAM.m1Prunus aviummRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database AF292108.1-CAM.m1 scaffold_4:25012070..25013886
AF292108.1

Sequence(s):
>AF292108.1-CAM.m1450
atggccgatcagctcacagacgaccagatctcagagttcaaggaggctttcagcctcttcgacaaggacggcgatggttg
catcactaccaaggagcttgggactgtcatgcgctcacttggtcagaacccaactgaagctgagcttcaggatatgatca
atgaggttgatgctgacgggaatggaaccattgatttccctgagtttcttaacctgatggccaggaagatgaaggacaca
gattctgaggaggagctcaaggaagccttccgggtgtttgataaggaccagaatggcttcatttctgctgctgagcttcg
tcatgttatgacaaatcttggtgagaagctgacagatgaggaagtggatgagatgattcgtgaggctgatgtggatggtg
atgggcagatcaactacgaggagttcgtcaaagtcatgatggccaagtga
back to top