CBF1, CBF1 (gene) Fragaria x ananassa

Gene Overview
Name CBF1
Gene Symbol CBF1
Type gene
Organism Fragaria x ananassa
Synonym CBF-like transcription factor
CRT/DRE-binding factor 1
Description NA
Comment CRT/DRE-binding factor 1; CBF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1EU117214.2-CBF1Fragaria x ananassagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1FJ767754.1-CBF1.m1Fragaria x ananassamRNA
CBF1EU117214.2-CBF1.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database EU117214.2-CBF1 N/A EU117214.2
mRNA parsed from NCBI nr database FJ767754.1-CBF1.m1 N/A FJ767754.1
mRNA parsed from NCBI nr database EU117214.2-CBF1.m1 N/A EU117214.2

Sequence(s):
>EU117214.2-CBF1794
gccattctccctcacttccagtcttaacttttatctaatagatttcacgcacacacggagttaactgacagttaatcact
tcaggcactgcacttattattgtacgtggattgcatgcttgaatcgtcgtcgcatagcgaaaacaattctgggggtgttg
gtcgaatgactttgtctgacgaagaggtcatgctggcgtcgagccggccgaagaggccggctgggaggaaggagtttcgg
gggactcggcatccggtgtatcggggagtgaggaggagggattcgggcaagtgggtttgtgaactgagggagccgaacaa
gaagtcgaggatttggctgggcacatttcccaccgccgaaatggcagcgcgggctcatgacgtggcggcgatcgctttga
gggggaggttagcttgtttgaacttcgctgactcttcttggcggctgccgttgccggcttccactgaccccaaggatatt
cagaaggccgctgcggaggcggccgaggcgttccggcccgagaaggatttgaggagggtggatgacaagatggacgagaa
agaagtggcggagaggacgacaatgtcggatggtgtgatttttatggacgaagaagcggtttttgggatgcccggattgt
tgacgaacagggccgaaggcatgctactccctccaccccattacaaggggtatgggggtgatgacatgggcaccgatgct
gatgtcagcttgtggagtttctccatttaattaagttagtttagatgttatagtgaagcagtaatcaggcggtc
back to top
>FJ767754.1-CBF1.m1636
atgcttgaatcgtcgtcgcatagcgaaaacaattctgggggtgttggtcgaatgactttgtctgacgaagaggtcatgct
ggcgtcgagccggccgaagaggccggctgggaggaaggagtttcgggggactcggcatccggtgtatcggggagtgagga
ggagggattcgggcaagtgggtttgtgaactgagggagccgaacaagaagtcgaggatttggctgggcacatttcccacc
gccgaaatggcagcgcgggctcatgacgtggcggcgatcgctttgagggggaggttagcttgtttgaacttcgctgactc
ttcttggcggctgccgttgccggcttccactgaccccaaggatattcagaaggccgctgcggaggcggccgaggcgttcc
ggcccgagaaggatttgaggagggtggatgacaagatggacgagaaagaagtggcggagaggacgacaatgtcggatggt
gtgatttttatggacgaagaagcggtttttgggatgcccggattgttgacgaacagggccgaaggcatgctactccctcc
accccattacaaggggtatgggggtgatgacatgggcaccgatgctgatgtcagcttgtggagtttctccatttaa
back to top
>EU117214.2-CBF1.m1636
atgcttgaatcgtcgtcgcatagcgaaaacaattctgggggtgttggtcgaatgactttgtctgacgaagaggtcatgct
ggcgtcgagccggccgaagaggccggctgggaggaaggagtttcgggggactcggcatccggtgtatcggggagtgagga
ggagggattcgggcaagtgggtttgtgaactgagggagccgaacaagaagtcgaggatttggctgggcacatttcccacc
gccgaaatggcagcgcgggctcatgacgtggcggcgatcgctttgagggggaggttagcttgtttgaacttcgctgactc
ttcttggcggctgccgttgccggcttccactgaccccaaggatattcagaaggccgctgcggaggcggccgaggcgttcc
ggcccgagaaggatttgaggagggtggatgacaagatggacgagaaagaagtggcggagaggacgacaatgtcggatggt
gtgatttttatggacgaagaagcggtttttgggatgcccggattgttgacgaacagggccgaaggcatgctactccctcc
accccattacaaggggtatgggggtgatgacatgggcaccgatgctgatgtcagcttgtggagtttctccatttaa
back to top