CBF1, CBF1 (gene) Malus x domestica

Gene Overview
Name CBF1
Gene Symbol CBF1
Type gene
Organism Malus x domestica
Synonym C-repeat binding factor transcriptional activator
CBF1
Description NA
Comment MdCBF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1HM992942.1-CBF1Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1HM992942.1-CBF1.m1Malus x domesticamRNA
CBF1DQ074478.1-CBF1.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM992942.1-CBF1 Chr07:33199099..33199765
chr7:23352715..23353381
chr7:27956070..27956736
HM992942.1
predicted genes from whole genome assembly HM992942.1-CBF1.m1 Chr07:33199099..33199765
chr7:23352715..23353381
chr7:27956070..27956736
HM992942.1
predicted genes from whole genome assembly DQ074478.1-CBF1.m1 Chr07:33199099..33199765
chr7:23352715..23353381
chr7:27956070..27956736
DQ074478.1

Sequence(s):
>HM992942.1-CBF1660
atggatggttgctctaattactacgtggacccaccgggggaatcgtcgtcggcttcggacaccagtcgccccatgttcct
gaccttgtcggacaaggaggtactgctggcgtctacttgcccgaagaagcgggctggacggaagaagtttagagagacac
ggcacccggtgtttcggggtgtaaggaggaggaactccggcaagtgggtgtgcgaggtgcgcgagcccaacaaaaagaca
aggatttggctgggcacttttcccacggcagaaatggccgcccgcgcgcacgacgtggcggcaattgcactgaggggcag
gtccgcctgccttaattttgctgactccgcgaggaggctgcctgtcccggcttcttccaacgccaaggacattcagacgg
ctgccacagaagcagcagaggcgtttcggcctactgaggagtcggatgaggtttgtggatcgcctgtggcggctccatcg
gagtccacgtccgcatcggagcagcaacaagtgttctatatggacgaggaggcggttttcgggatgccgggactgctggc
agatatggcggaaggaatgctattgcctccaccccattacagtgatgatgatgacgtggatgtttgtgctgacgtgccct
tatggagtttttccatttaa
back to top
>HM992942.1-CBF1.m1660
atggatggttgctctaattactacgtggacccaccgggggaatcgtcgtcggcttcggacaccagtcgccccatgttcct
gaccttgtcggacaaggaggtactgctggcgtctacttgcccgaagaagcgggctggacggaagaagtttagagagacac
ggcacccggtgtttcggggtgtaaggaggaggaactccggcaagtgggtgtgcgaggtgcgcgagcccaacaaaaagaca
aggatttggctgggcacttttcccacggcagaaatggccgcccgcgcgcacgacgtggcggcaattgcactgaggggcag
gtccgcctgccttaattttgctgactccgcgaggaggctgcctgtcccggcttcttccaacgccaaggacattcagacgg
ctgccacagaagcagcagaggcgtttcggcctactgaggagtcggatgaggtttgtggatcgcctgtggcggctccatcg
gagtccacgtccgcatcggagcagcaacaagtgttctatatggacgaggaggcggttttcgggatgccgggactgctggc
agatatggcggaaggaatgctattgcctccaccccattacagtgatgatgatgacgtggatgtttgtgctgacgtgccct
tatggagtttttccatttaa
back to top
>DQ074478.1-CBF1.m1660
atggatggttgctctaattactacgtggacccaccgggggaatcgtcgtcggcttcggacaccagtcgccccatgttcct
gaccttgtcggacaaggaggtactgctggcgtctacttgcccgaagaagcgggctggacggaagaagtttagagagacac
ggcacccggtgtttcggggtgtaaggaggaggaactccggcaagtgggtgtgcgaggtgcgcgagcccaacaaaaagaca
aggatttggctgggcacttttcccacggcagaaatggccgcccgcgcgcacgacgtggcggcaattgcactgaggggcag
gtccgcctgccttaattttgctgactccgcgaggaggctgcctgtcccggcttcttccaacgccaaggacattcagacgg
ctgccacagaagcagcagaggcgtttcggcctactgaggagtcggatgaggtttgtggatcgcctgtggcggctccatcg
gagtccacgtccgcatcggagcagcaacaagtgttctatatggacgaggaggcggttttcgggatgccgggactgctggc
agatatggcggaaggaatgctattgcctccaccccattacagtgatgatgatgacgtggatgtttgtgctgacgtgccct
tatggagtttttccatttaa
back to top