CBF1, CBF1 (gene) Prunus dulcis

Gene Overview
Name CBF1
Gene Symbol CBF1
Type gene
Organism Prunus dulcis
Synonym C-repeat binding factor 1
Description NA
Comment PrdCBF1
AcCBF1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1JQ317157.1-CBF1Prunus dulcisgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF1JQ317157.1-CBF1.m1Prunus dulcismRNA
CBF1KJ818900.1-CBF1.m1Prunus dulcismRNA
CBF1KM245570.1-CBF1.m1Prunus dulcismRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFPrunus dulcisgene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
gene parsed from NCBI nr database JQ317157.1-CBF1 N/A JQ317157.1
mRNA parsed from NCBI nr database JQ317157.1-CBF1.m1 scaffold_5:10085520..10086243
JQ317157.1
mRNA parsed from NCBI nr database KJ818900.1-CBF1.m1 N/A KJ818900.1
mRNA parsed from NCBI nr database KM245570.1-CBF1.m1 N/A KM245570.1

Sequence(s):
>JQ317157.1-CBF12436
gattacgtcatcccaactgttcatgcaaacaattgaactggactggactaaggtaaagtttgtgggtcacataaaaataa
acttgattaaataaaaggtcaatgaaatgaaacaatatgaaagacacgtgtcttgttctaattgatattggatcaaagta
acgtaaatctattatgttatgtttcacagtctcaaggtatagcagatcaatcaaccatgacacaaaatctaaattaaact
ttaattaatgtaatggaacatctgcttgtgaaaactcaacatttttactggaaaatgaatataatcaagggaacttattt
tcccgtttctattttgcctacttacacttctttcgttggaaattgtatgtttttatattttttttatatattttttttta
tagagattcactattatacccaatataagggcccaatttatatttaaaaaaatcttatataaaatgaattttagaaacac
accaaaaacctatttataacataataaaaaggcttttaacttcttataaattacaaaactgctattaatttcttaaaaaa
aacctaatcccaaaacctcataaaaatacccaaaactcaatagggcatcaaagtaatttaataatcaaaattaaattcaa
tagaccagctgtcattttttgggttttttgtttgtttatttacagaaattaaatgatgtacggttatttatattattaat
attaaaaatgggtatatgactaaatatcctctatttttttgggtcaacctacactcttttttatatataattataatagt
ttgtgcacgtgttataagtagacaacaatattaatatttctcattttaaaaaataatattaataaatattcaattatatt
ataatacgtagataaattataacacatgaccgtattactgtattaaattatagcaccggtaaggttgtaattagtgcgaa
agaaagataaaataaaaaaacattgcagtagcccgcatgagctgaggtgaggtgtgagtggagccacgtaacgcacactt
caaacacagacaacgtgtcaatttttagtaataaaaccacgtgtgattaaaaaaaagcacccgcttattagtttcgtaaa
cttaatgtgcttccgacccaaaaactaacctaagtgtgttttactgccacgtggcagagccaagtcaaagcaatgttttc
tgcctccagctcccgatgaatcccccttggtcaatttacttgccactctagtagtaaagccgcatttcgagctggcccca
catgtctccttccttaggctccttccgcagactccgtgtttacgtgtccacacttcggccgcagctgccacgcaatcccc
aatctataaaagtccctctccctcacttccaatttcggctcaagaaactcaaccaagctaaaacaccaaaccattcatac
atatcttacgctaatgaacaggttcttctctcatttttctgactccgtcgaccagcccgagtcaagttcgttgtccgaca
acacagtcacgactctaagggcttcttggtccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctggg
aggagggttttcaaggagaccaggcaccctgtttataggggcgtgaggaggaggaacaatgacaagtgggtgtgtgaaat
gagagagcccaagaagacgaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacg
tggcggcattggcgtttagagggaagcttgcctgcctcaacttccctgactccgcttggaggctgcccttgccggcttcc
atggatgcaatggatattcggagagcggccgccgaggcagctgaggggtttaggccggtggagtttggtggagtgtccag
cagcagcagtgatgagaaggagagaatggtggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaata
tggaaaaaagtacaagcttgagcttgtcctattgggatgaggaagaagtgtttgacatgccaaggttgcttgatgacatg
gctcaaggccttcttctttctccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctgatgtcaa
attgtggagtttctccaattaataatcaacgtttatttggaaatattgaatataaaaggtatatatgagaaagatatttt
tagtggagatagatatttaggattgtgtacagtagaaaagtttactaactgtggattcattgaattgctttctctttact
gggttccttggctgctcactttgttttgttggcttcctttgtgtccctgttggttttgaccgttgtaatttgattttcat
tctttttatatgaattgaaagcttttatgtgtttgg
back to top
>JQ317157.1-CBF1.m1729
atgaacaggttcttctctcatttttctgactccgtcgaccagcccgagtcaagttcgttgtccgacaacacagtcacgac
tctaagggcttcttggtccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctgggaggagggttttca
aggagaccaggcaccctgtttataggggcgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaag
aagacgaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggcggcattggc
gtttagagggaagcttgcctgcctcaacttccctgactccgcttggaggctgcccttgccggcttccatggatgcaatgg
atattcggagagcggccgccgaggcagctgaggggtttaggccggtggagtttggtggagtgtccagcagcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaatatggaaaaaagtac
aagcttgagcttgtcctattgggatgaggaagaagtgtttgacatgccaaggttgcttgatgacatggctcaaggccttc
ttctttctccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctgatgtcaaattgtggagtttc
tccaattaa
back to top
>KJ818900.1-CBF1.m1729
atgaacaggttcttctctcatttttctgactccgtcgaccagcccgagtcaagttcgttgtccgacgccacagtcacgac
tctaagggcttcttggtccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctgggaggagggttttca
aggagaccaggcaccctgtttataggggcgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaag
aagacgaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggcggcattggc
gtttagagggaagcttgcctgcctcaacttccctgactccgcttggaggctgcccttgccggcttccatggatgcaatgg
atattcggagagcggccgccgaggcagctgaggggtttaggccggtggagtttggtggagtgtccagcagcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaatatggaaaaaagtac
aagcttgagcttgtcctattgggatgaggaagaagtgtttgacatgccaaggttgcttgatgacatggctcaaggccttc
ttctttctccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctgatgtcaaattgtggagtttc
tccaattaa
back to top
>KM245570.1-CBF1.m1729
atgaacaggttcttctctcatttttctgactccgtcgaccagcccgagtcaagttcgttgtccgacaacacagtcacgac
tctaagggcttcttggtccgacgaggacgtcattttggcgtcgagccgaccaaagaagcgagctgggaggagggttttca
aggagaccaggcaccctgtttataggggcgtgaggaggaggaacaatgacaagtgggtgtgtgaaatgagagagcccaag
aagacgaagtccaggatatggctcgggacttatccgacggcggagatggctgctcgtgcccatgacgtggcggcattggc
gtttagagggaagcttgcctgcctcaacttccctgactccgcttggaagctgcccttgccggcttccatggatgcaatgg
atattcggagagcggccgccgaggcagctgaggggtttaggccggtggagtttggtggagtgtccagcagcagcagtgat
gagaaggagagaatggtggtgcaggtggaagagaagaagaagaagaagaagaaggatagtgtgaatatggaaaaaagtac
aagcttgagcttgtcctattgggatgaggaagaagtgtttgacatgccaaggttgcttgatgacatggctcaaggccttc
ttctttctccacctcaatgcttaggtggcgacatttgggatgacatgggaaccgatgctgatgtcaaattgtggagtttc
tccaattaa
back to top