CBF2, CBF2 (gene) Malus x domestica

Gene Overview
Name CBF2
Gene Symbol CBF2
Type gene
Organism Malus x domestica
Synonym C-repeat binding factor 2
C-repeat binding factor transcriptional activator
Description NA
Comment MdCBF2
CBF2; AP2/ ERF domain transcription factor
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF2HM992941.1-CBF2Malus x domesticagene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF2KC603712.1-CBF2.m1Malus x domesticamRNA
CBF2HM992941.1-CBF2.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly HM992941.1-CBF2 Chr06:17755212..17755746
chr6:12937652..12938186
HM992941.1
predicted genes from whole genome assembly KC603712.1-CBF2.m1 Chr06:17755037..17755746
chr6:12937652..12938361
KC603712.1
predicted genes from whole genome assembly HM992941.1-CBF2.m1 Chr06:17755212..17755746
chr6:12937652..12938186
HM992941.1

Sequence(s):
>HM992941.1-CBF2534
atgaatacgatcttcagtactcaactctccgattcctctgaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaagtgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggccgctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgagacggagagcaagaaaatggaggaggagaaggattgtgggggcgtg
back to top
>KC603712.1-CBF2.m1711
atgaatacgatcttcagtactcaactctccgattcctcngaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaaatgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggcngctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgaganggagagcaagaaaatggaggaggagaaggattgtggnggcgtggagggaagtggaatcttgttttactt
ggatgaggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccgcctcactctt
caggtggctacatgaactgggatgacatgggaagcaatgatgacgtcagtctgtggagcttctcaaattag
back to top
>HM992941.1-CBF2.m1534
atgaatacgatcttcagtactcaactctccgattcctctgaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaagtgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggccgctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgagacggagagcaagaaaatggaggaggagaaggattgtgggggcgtg
back to top