CBF4, CBF4 (gene) Fragaria x ananassa

Gene Overview
Name CBF4
Gene Symbol CBF4
Type gene
Organism Fragaria x ananassa
Synonym C-repeat binding factor 4
Description NA
Comment CBF4
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF4HQ910515.1-CBF4.m1Fragaria x ananassamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFFragaria x ananassagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HQ910515.1-CBF4.m1 N/A HQ910515.1

Sequence(s):
>HQ910515.1-CBF4.m1595
atgctcgagtcttcttctcactccgataacaacagcggcggcgttgggcggatggccttgtcagacgaggaggtcatgct
ggcggagacgtacccgaagaagagggcgggaaggaagaagttcaaggagacgaggcacccggtttaccgcggtgtgagga
ggagaaactccggcaagtgggtttgcgaggttcgtgagccgaacaagaagacgaggatttggcttgggactttccccact
accgaaatggctgcgcgtgcccacgacgtggcggcgattgccttgaggggccggaatgcgtgtttgaactttgccgactc
ggcgtggcggctgccggtgccggcttctaatagtgctaaggacatacagacggcggctgctgaggcggcggaggcgtttc
ggcctaataggggggaatcggaagttgtgtcgaaagcgacggaggcggtggaagaggaatcggaacaaccggtgttttat
atggacgaggaggatgtgtttgggatgccggggttgctggccaacatggcggaagggatgctactgccgcctcctcacta
taacggatacggaggagacgaatatgaagggcgaa
back to top