CBF5, CBF5 (gene) Malus x domestica

Gene Overview
Name CBF5
Gene Symbol CBF5
Type gene
Organism Malus x domestica
Synonym C-repeat binding factor 5
Description NA
Comment CBF5; AP2/ ERF domain transcription factor
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBF5KC603713.1-CBF5.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KC603713.1-CBF5.m1 Chr01:29427232..29427893
chr1:25251007..25251668
chr1:31530730..31531391
KC603713.1

Sequence(s):
>KC603713.1-CBF5.m1663
atggatgctttctctcattactacgtggacccgcagccggaatcgtcgtccgcttctgacgccaacagttctcgccccat
gttcatgaacttgtcggacgaggaggtcctgctggcgtccacttacccgaagaagcaggctggacggaagaagtttaaag
agacaaggcaccctgtgtaccgcggtgtccggaggaggaactccggcaagtgggtgtccgaggtccgggagcccaacaaa
aagacaaggatttggctgggaacatttcccacagccgaaatggccgcgcgcgctcatgatgtggcggccattgcgctgag
ggggaggtcggcttgcctcaactttgccgactctgcgtggcggctaccagtcccggcctccgccaacgcgaaggatattc
aaactgccgcggcggaagcagcagaacagtttcggccggtggaagagtcggatgaggcttgtggtgcttctgcggtggct
ccctcggagtgcacgtcagcgccggagcaacaagtgcattttatggatgaggaagcggtttttgggatgccgggactgct
ggcaaatatggcggaaggaatgctactgcctccacctcattacaatgccgatgatgtcgtggatgtttatgcggacgtgc
cattatggagtttttccatttag
back to top