CBFA, CBFA (gene) Prunus mume

Gene Overview
Name CBFA
Gene Symbol CBFA
Type gene
Organism Prunus mume
Synonym CBF/DREB1-like protein a
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFAHM099909.2-CBFA.m1Prunus mumemRNA
CBFAHM099907.1-CBFA.m1Prunus mumemRNA
CBFAKU587042.1-CBFA.m1Prunus mumemRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFPrunus mumegene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database HM099909.2-CBFA.m1 N/A HM099909.2
mRNA parsed from NCBI nr database HM099907.1-CBFA.m1 N/A HM099907.1
mRNA parsed from NCBI nr database KU587042.1-CBFA.m1 N/A KU587042.1

Sequence(s):
>HM099909.2-CBFA.m1696
atggacatgttctccgctcagctttctgactcccctgaccagcccgagtcgagttctttctccgacgccagcgtcaccac
cctgccggcttcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggcgtgaggagaaggaacaacaacaagtgggtgtgtgagttgagagagcccaac
aagaagaaatcaaggatttggcttggaacgtatccgactgctgagatggctgctcgtgcacatgacgtggcggcattggc
tttcagagggaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggatactatgg
atatccgaagggcagccgctgaggccgccgaagggttcaggccagcggagttcggtggattatccagctgcagcagtgat
gagaaggagaagatttttagcgtggatatggaaaaaagcagcagcagcttgtgcttgttttatttggatgaggaggaaat
gtttgatatgccaaggttgattgataacatggctcaagggcttcttctttctccacctcaatgctcagctggctacttga
actgggatgacatggaaacggaagctgatgccaaactatggagtttctctatctga
back to top
>HM099907.1-CBFA.m1366
ttacaggggcgtgaggagaaggaacaacaacaagtgggcgtgtgagttgagagagcccaacaagaagaaatcaaggattt
ggcttggaacgtatccgactgctgagatggctgctcgtgcatatgacgtggcggcattggctttcagagggaagcttgcc
tgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggataccatggatatccgaagggcagccgc
tggggccgccgaagggttcaggccagcggagttcggtggattatccagctgcagcagtgatgagaaggagaagattttta
gcgtggatatggaaaaaagcagcagcagcttgtgcttgttttattt
back to top
>KU587042.1-CBFA.m1696
atggacatgttctccgctcagctttctaactcccccgaccagcccgagtcgagttctttctccgacgccagcttcaccac
cctgccggcttcttcctccgacgaaaacgtcatattggcgtcgagccggccgaagaagcgcgctgggaggagggttttca
aggagacgaggcacccggtttacaggggggtgaggagaaggaacaacaacaagtgggtgtgtgagttgagagagccaaac
aagaagaaatcaaggatttggcttggaacgtatccgactgctgagatggctgctcgtgcccatgacgtggcggcattggc
gttcagagggaagcttgcctgcataaactttgctgactccgcatggcggctgcccttgccggcttccatggataccatgg
atatccgaagggcagctgctgaggccgccgaagggttcaggccagcggagttcggtggattatccagctgcagcagtgat
gagaaggagaagatttttagcgtggatgtggaaaaaagcagcagcagcttgtgcttgttttatttggatgaggaggaaat
gtttgatatgccaaggttgattgataacatggctcaagggcttcttctttctccacctcaatgttcagctggctacttga
actgggatgacatggaaactgaagctgatgccaaactatggagtttctctatctga
back to top