CBF, CBF (gene) Malus baccata

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Malus baccata
Synonym CBF/DREB1 transcription factor
DREB1
Description NA
Comment CBF1; Cbf1
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFEF582842.1-CBF.m1Malus baccatamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus baccatagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly EF582842.1-CBF.m1 Chr04:9200515..9201271
chr4:4894473..4895229
chr4:5294473..5295229
EF582842.1

Sequence(s):
>EF582842.1-CBF.m1756
atggacacgatctccagacaactctccgattccgccgaaaagcccgaatcgagttccgaaagcgtcacgactcgaagcca
gctgacttcgttctccgatgaggaggtcattttggcatccagcacgccgaagaagcgagcggggaggagagttttcaacg
agacaaggcaccccgtttacagaggagtgaggaggaggaacaacgacaagtgggtgtgcgaaatgagagaaccaaacaag
aagaagtcgaggatatggctcggagcttatccaacggcagagatggcagctcgggcgcatgacgtggcggcattggcctt
tagagggaggcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcttccactgattcagtggata
tcaggcgggcggccgcggaggctgcagagacattcaggccagccgagtttggcggagtgtcggaaagtggggatgatgag
aaggagagcaagaaaatggagggggagaaggattgtggatgtgcggagcagagcgattgtggacgtgcggagcaaagcga
ttgtggaggtgcggagcaaagtggcagctcgttttacttggatgaggaggaaatgttcgccatgccaaggttgcttgata
gtatggcggaagggcttctgctctctccacctcgccgttcagctggtagcaatatgaactgggatgatatgggaagtaac
gatgatgacgtcaatctgtggagcttctcaaagtaa
back to top