CBF, CBF (gene) Malus x domestica

Gene Overview
Name CBF
Gene Symbol CBF
Type gene
Organism Malus x domestica
Synonym CBF/DREB 2
CBF/DREB 3
CBF/DREB 4
DREB 2
DREB 3
DREB 4
Description NA
Comment AP2/ERF transcription factor family; low temperature response pathway
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
CBFKC543505.1-CBF.m1Malus x domesticamRNA
CBFKC543504.1-CBF.m1Malus x domesticamRNA
CBFKC543503.1-CBF.m1Malus x domesticamRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
C-repeat binding factorCBFMalus x domesticagene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
predicted genes from whole genome assembly KC543505.1-CBF.m1 Chr06:17755035..17755746
chr6:12937652..12938363
KC543505.1
predicted genes from whole genome assembly KC543504.1-CBF.m1 Chr06:17779624..17780323
chr6:12921280..12921979
KC543504.1
predicted genes from whole genome assembly KC543503.1-CBF.m1 Chr04:9200515..9201271
chr4:4894473..4895229
chr4:5294473..5295229
KC543503.1

Sequence(s):
>KC543505.1-CBF.m1711
atgaatacgatcttcagtactcaactctccgattcctcygaaaagcccgaatcgagttccgacgacacaagcatcacggc
tcaaagccagctggcttccttctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcggggaggagag
ttttcaaggagacgaggcacccagtttacagaggagttaggaggaggaacaacaacaagtgggtgtgcgaaatgagggaa
ccaaacaagaagaagtcgaggatatggctcggaacttatccgacggccgagatggcagctcgggcgcatgacgtggcggc
attggcctttagagggaagcttgcctgcctcaattttgcagactccgcatggcgcctgcctgttccggcatccattgatt
cagtggatatcagacgggcsgctgcggaggctgcagagacgttccggccagcggagtttggcggagtgttggaaagcggc
gatgatgagamggagagcaagaaaatggaggaggagaaggattgtggrggcgtggagggaagtggaatcttgttttactt
ggatgaggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccgcctcactctt
caggtggctacatgaactgggatgacatgggaagcaatgatgacgtcagtctgtggagcttctcaaattga
back to top
>KC543504.1-CBF.m1702
atgaatacgatcttcagtcaaatctccgattcctccgaaaagccsgaatcgagctccgacgacacaagcatcttgactcg
aagccagctggcttcgttctccgacgaggtcattttggcgtccarcaggccgaagaagcgagcrgggaggagagttttca
aggagacgaggcacccgrtttacagaggagtgaggaggaggaacaacaacaagtgggtgtgcgaaatgagagaaccaaac
aaaaagaagtcgaggatatggctcggaacttatcwgacggccgagatggcagctcgggcgcatgacgtggcggcattggc
ctttagagggaagcttgcctgcctcaattttgcagactccgtatggcgcctgcccgttccggcatccactgattcagtgg
atatcaggcgggcagcagcggaggctgcagagacsttccggccagaggagtttggcggagtgtcggaaagcggcgatgat
gagaaggagwgcaagaaaatggagggggagaaggattgtggaggcgcggaggaaagtggaatcttgttktacttggatga
ggaggaaatgttcgacatgccaaggttgctggatagtatggcggaagggcttctgctctctccacctcactcttcaggtg
gctacatgaactgggatgacatggaaagcaacgatgacgtcagtctgtggagcttctcataa
back to top
>KC543503.1-CBF.m1756
atgaacacratctccagacaactctccgattccgccgaaaggcccgaatcgagttccgaaagcgtcacgamtcgaagcca
gccgacttcgttctccgatgaggaggtcattttggcgtccagcacgccgaagaagcgagcggggaggagagttttcaacg
agacaaggcaccccgtttacagaggagtgaggaggaggaacaacgacaagtgggtgtgcgaaatgagagaaccaaacaag
aagaagtcgaggatatggctcggaacttatccaacggcagagatggcagctcgggcgcatgacgtggcggcattggcctt
tagagggaggcttgcctgcctcaattttgcagactccgcatggcgcctgcctgtcccrgcttccactgattcagtggata
tcaggcgggcggccgcggaggctgcagagacattcaggccagccgagtttggcggagtgtcggaaagtggggatgatgag
aaggagagcaagaaaatggagggggagaaggattgtggatgtgcggagcaaagcgattgtggaggtgcggagcaaagcga
ttgtggaggtgcggagcaaagtggcagctcgttttacttggatgaggaggaaatgttcgccatgccaaggttgcttgata
gtatggcggaaggscttctgctctctccacctcgccgttcagctggtagcaacatgaactgggatgatatgggaagcaat
gatgatgacgtcaatctgtggagcttctcaaagtaa
back to top